2023-OPA-8854PCT KR 10-2023-0104783 2023-08-10 CAREGEN CO., LTD Novel Peptide Having Activity of Improving Dry Eye Disease and Uses Thereof 17 10 AA PAT source 1..10 mol_type protein organism synthetic construct TLKKNKRFSK 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct cgactactacaaccctccgc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct gggaggagttggtacacacg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct aaggtggctgaccaagatgg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tctcgtttgtcatcaccccg 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct atcattcaccaggcaaattgc 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct ggcttcagcataaagcgtttg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ttcgacacatgggataacga 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tctttcaacacgcaggacag 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct aaagaggcactgccagaaaa 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct atctgaggtgcccatgctac 27 DNA PAT source 1..27 mol_type other DNA organism synthetic construct caaaacatatttctttgtagaggacaa 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ttcagctatttgcttgggaa 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct gggacgcagacatcgtcatc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tcgtcatcgtcgaaatgggc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ggagccaaaagggtcatcat 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct gtgatggcatggactgtggt