P6107601WO EP 22172149.1 2022-05-06 Academisch Ziekenhuis Leiden h.o.d.n. LUMC Oligonucleotide 75 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule source 1..20 mol_type other RNA organism synthetic construct cctctgagctactccaggtt 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule source 1..20 mol_type other RNA organism synthetic construct aacctctgagctactccagg 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule source 1..20 mol_type other RNA organism synthetic construct caaacctctgagctactcca 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule source 1..20 mol_type other RNA organism synthetic construct cacaaacctctgagctactc 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule source 1..20 mol_type other RNA organism synthetic construct agcacaaacctctgagctac 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule source 1..20 mol_type other RNA organism synthetic construct tcagcacaaacctctgagct 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule source 1..20 mol_type other RNA organism synthetic construct aatcagcacaaacctctgag 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule source 1..20 mol_type other RNA organism synthetic construct aaaatcagcacaaacctctg 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule source 1..20 mol_type other RNA organism synthetic construct ggaaaatcagcacaaacctc 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule source 1..20 mol_type other RNA organism synthetic construct gaggaaaatcagcacaaacc 19 RNA PAT misc_feature 1..19 note antisense nucleic acid molecule source 1..19 mol_type other RNA organism synthetic construct agcacaaacctctgagcta 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct cctctgagctactccaggtt 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct aacctctgagctactccagg 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct caaacctctgagctactcca 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct cacaaacctctgagctactc 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct agcacaaacctctgagctac 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct tcagcacaaacctctgagct 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct aatcagcacaaacctctgag 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct aaaatcagcacaaacctctg 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct ggaaaatcagcacaaacctc 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct gaggaaaatcagcacaaacc 19 RNA PAT misc_feature 1..19 note antisense nucleic acid molecule misc_feature 1..18 note phosphorothioate nucleotide misc_feature 1..19 note 2'-O-methyl modified ribonucleic acid source 1..19 mol_type other RNA organism synthetic construct agcacaaacctctgagcta 19 RNA PAT modified_base 18 mod_base OTHER note thymine misc_feature 1..19 note antisense nucleic acid molecule misc_feature 1..18 note phosphorothioate nucleotide misc_feature 1..5 note 2-methoxy ethyl modified ribonucleic acid misc_feature 15..19 note 2-methoxy ethyl modified ribonucleic acid misc_feature 6..14 note 2'-O-methyl modified ribonucleic acid source 1..19 mol_type other RNA organism synthetic construct agcacaaacctctgagcta 19 RNA PAT modified_base 11 mod_base OTHER note thymine modified_base 13 mod_base OTHER note thymine modified_base 18 mod_base OTHER note thymine misc_feature 1..19 note antisense nucleic acid molecule misc_feature 1..18 note phosphorothioate nucleotide misc_feature 1..19 note 2-methoxy ethyl modified ribonucleic acid source 1..19 mol_type other RNA organism synthetic construct agcacaaacctctgagcta 19 RNA PAT modified_base 18 mod_base OTHER note thymine misc_feature 1..19 note antisense nucleic acid molecule misc_feature 1..18 note phosphorothioate nucleotide misc_feature 1..2 note 2-methoxy ethyl modified ribonucleic acid misc_feature 18..19 note 2-methoxy ethyl modified ribonucleic acid misc_feature 3..17 note 2'-O-methyl modified ribonucleic acid source 1..19 mol_type other RNA organism synthetic construct agcacaaacctctgagcta 19 RNA PAT misc_feature 1..19 note antisense nucleic acid molecule misc_feature 1..18 note phosphorothioate nucleotide misc_feature 1..19 note 2'-O-methyl modified ribonucleic acid misc_feature 3 note m5c misc_feature 5 note m5c misc_feature 9..10 note m5c misc_feature 12 note m5c misc_feature 17 note m5c source 1..19 mol_type other RNA organism synthetic construct agcacaaacctctgagcta 20 RNA PAT modified_base 1 mod_base OTHER note thymine modified_base 20 mod_base OTHER note thymine misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..5 note 2-methoxy ethyl modified ribonucleic acid misc_feature 16..20 note 2-methoxy ethyl modified ribonucleic acid misc_feature 6..15 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct tcagcacaaacctctgagct 20 RNA PAT modified_base 1 mod_base OTHER note thymine modified_base 13 mod_base OTHER note thymine modified_base 15 mod_base OTHER note thymine modified_base 20 mod_base OTHER note thymine misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2-methoxy ethyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct tcagcacaaacctctgagct 20 RNA PAT modified_base 1 mod_base OTHER note thymine modified_base 20 mod_base OTHER note thymine misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..2 note 2-methoxy ethyl modified ribonucleic acid misc_feature 19..20 note 2-methoxy ethyl modified ribonucleic acid misc_feature 3..18 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct tcagcacaaacctctgagct 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2'-O-methyl modified ribonucleic acid misc_feature 2 note m5c misc_feature 5 note m5c misc_feature 7 note m5c misc_feature 11..12 note m5c misc_feature 14 note m5c misc_feature 19 note m5c source 1..20 mol_type other RNA organism synthetic construct tcagcacaaacctctgagct 20 RNA PAT modified_base 3 mod_base OTHER note thymine modified_base 17 mod_base OTHER note thymine misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..5 note 2-methoxy ethyl modified ribonucleic acid misc_feature 16..20 note 2-methoxy ethyl modified ribonucleic acid misc_feature 6..15 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct aatcagcacaaacctctgag 20 RNA PAT modified_base 3 mod_base OTHER note thymine modified_base 15 mod_base OTHER note thymine modified_base 17 mod_base OTHER note thymine misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2-methoxy ethyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct aatcagcacaaacctctgag 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..2 note 2-methoxy ethyl modified ribonucleic acid misc_feature 19..20 note 2-methoxy ethyl modified ribonucleic acid misc_feature 3..18 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct aatcagcacaaacctctgag 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2'-O-methyl modified ribonucleic acid misc_feature 4 note m5c misc_feature 7 note m5c misc_feature 9 note m5c misc_feature 13..14 note m5c misc_feature 16 note m5c source 1..20 mol_type other RNA organism synthetic construct aatcagcacaaacctctgag 20 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 17 mod_base OTHER note thymine modified_base 19 mod_base OTHER note thymine misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..5 note 2-methoxy ethyl modified ribonucleic acid misc_feature 16..20 note 2-methoxy ethyl modified ribonucleic acid misc_feature 6..15 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct aaaatcagcacaaacctctg 20 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 17 mod_base OTHER note thymine modified_base 19 mod_base OTHER note thymine misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2-methoxy ethyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct aaaatcagcacaaacctctg 20 RNA PAT modified_base 19 mod_base OTHER note thymine misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..2 note 2-methoxy ethyl modified ribonucleic acid misc_feature 19..20 note 2-methoxy ethyl modified ribonucleic acid misc_feature 3..18 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct aaaatcagcacaaacctctg 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2'-O-methyl modified ribonucleic acid misc_feature 6 note m5c misc_feature 9 note m5c misc_feature 11 note m5c misc_feature 15..16 note m5c misc_feature 18 note m5c source 1..20 mol_type other RNA organism synthetic construct aaaatcagcacaaacctctg 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct aaaatcagctcaaacctctg 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct aaaaccagctcaaacctctg 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct aaaaccagctcaaacatctg 20 RNA PAT misc_feature 1..20 note antisense nucleic acid molecule misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..5 note 2'-O-methyl modified ribonucleic acid misc_feature 16..20 note 2'-O-methyl modified ribonucleic acid misc_feature 6..15 note deoxyribonucleic acid source 1..20 mol_type other RNA organism synthetic construct aaaatcagcacaaacctctg 16 RNA PAT modified_base 4 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine modified_base 10 mod_base OTHER note thymine modified_base 14..16 mod_base OTHER note thymine misc_feature 1..16 note antisense nucleic acid molecule misc_feature 1..15 note phosphorothioate nucleotide misc_feature 1..3 note locked nucleic acid misc_feature 14..16 note locked nucleic acid misc_feature 4..13 note deoxyribonucleic acid source 1..16 mol_type other RNA organism synthetic construct acatcctgctccattt 15 RNA PAT modified_base 3 mod_base OTHER note thymine modified_base 8..9 mod_base OTHER note thymine modified_base 12..13 mod_base OTHER note thymine misc_feature 1..15 note antisense nucleic acid molecule misc_feature 1..14 note phosphorothioate nucleotide misc_feature 1..3 note locked nucleic acid misc_feature 13..15 note locked nucleic acid misc_feature 4..12 note deoxyribonucleic acid source 1..15 mol_type other RNA organism synthetic construct ggtgaaattccttac 16 RNA PAT modified_base 4 mod_base OTHER note thymine modified_base 9..10 mod_base OTHER note thymine modified_base 13..14 mod_base OTHER note thymine misc_feature 1..16 note antisense nucleic acid molecule misc_feature 1..15 note phosphorothioate nucleotide misc_feature 1..3 note locked nucleic acid misc_feature 14..16 note locked nucleic acid misc_feature 4..13 note deoxyribonucleic acid source 1..16 mol_type other RNA organism synthetic construct gggtgaaattccttac 20 DNA PAT misc_feature 1..20 note 440BKVs primer source 1..20 mol_type other DNA organism synthetic construct gaaaaggagagtgtccaggg 26 DNA PAT misc_feature 1..26 note 441BKVas primer source 1..26 mol_type other DNA organism synthetic construct gaacttctactcctccttttattagt 20 DNA PAT misc_feature 1..20 note Taqman probe 576BKV-TQ-FAM FAM misc_feature 20 note conjugated to BHQ1 source 1..20 mol_type other DNA organism synthetic construct ccaaaaagccaaaggaaccc 22 DNA PAT misc_feature 1..22 note GADPH forward primer source 1..22 mol_type other DNA organism synthetic construct acaactttggtatcgtggaagg 19 DNA PAT misc_feature 1..19 note GADPH reverse primer source 1..19 mol_type other DNA organism synthetic construct gccatcacgccacagtttc 23 DNA PAT misc_feature 1..23 note Tag forward primer source 1..23 mol_type other DNA organism synthetic construct gaggaggatgtaaaggtagctca 23 DNA PAT misc_feature 1..23 note Tag reverse primer source 1..23 mol_type other DNA organism synthetic construct actggcaaacatatcttcatggc 20 DNA PAT misc_feature 1..20 note VP1 forward primer source 1..20 mol_type other DNA organism synthetic construct tgcagggtcacaaaaagtgc 20 DNA PAT misc_feature 1..20 note VP1 reverse primer source 1..20 mol_type other DNA organism synthetic construct agcactccctgcatttccaa 39 DNA PAT misc_feature 1..39 note Donor site I, IV source 1..39 mol_type other DNA organism synthetic construct gaactggagtagctcagaggtttgtgctgattttcctct 39 DNA PAT misc_feature 1..39 note Donor site II, III source 1..39 mol_type other DNA organism synthetic construct gaactggaatagctcagaggtttgtgctgattttcctct 39 DNA PAT misc_feature 1..39 note Donor site consensus source 1..39 mol_type other DNA organism synthetic construct gaactggartagctcagaggtttgtgctgattttcctct 37 DNA PAT misc_feature 1..37 note Acceptor site I misc_feature 15 note 2-methoxy ethyl modified ribonucleic acid source 1..37 mol_type other DNA organism synthetic construct taattatttktttttaggtgccaacctatggaacaga 40 DNA PAT misc_feature 1..40 note Acceptor site II source 1..40 mol_type other DNA organism synthetic construct taattatttttttkttataggtgccaacctatggaacaga 40 DNA PAT misc_feature 1..40 note Acceptor site III source 1..40 mol_type other DNA organism synthetic construct taattattttttttttataggtgccaacctatggaacaga 40 DNA PAT misc_feature 1..40 note Acceptor site IV, without gap source 1..40 mol_type other DNA organism synthetic construct taattatkttttttttataggtgccaacctatggaacaga 39 DNA PAT misc_feature 1..39 note Acceptor site IV, with gap source 1..39 mol_type other DNA organism synthetic construct taattakttttttttataggtgccaacctatggaacaga 39 DNA PAT misc_feature 1..39 note Acceptor site consensus, without gaps misc_feature 17 note 2-methoxy ethyl modified ribonucleic acid source 1..39 mol_type other DNA organism synthetic construct taattatktttktttttaggtgccaacctatggaacaga 38 DNA PAT misc_feature 1..38 note Acceptor site consensus, with 1 gap misc_feature 16 note 2-methoxy ethyl modified ribonucleic acid source 1..38 mol_type other DNA organism synthetic construct taattattttktttttaggtgccaacctatggaacaga 38 DNA PAT misc_feature 1..38 note Acceptor site consensus, with 1 gap misc_feature 16 note 2-methoxy ethyl modified ribonucleic acid source 1..38 mol_type other DNA organism synthetic construct taattaktttktttttaggtgccaacctatggaacaga 37 DNA PAT misc_feature 1..37 note Acceptor site consensus, with 2 gaps misc_feature 15 note 2-methoxy ethyl modified ribonucleic acid source 1..37 mol_type other DNA organism synthetic construct taattatttktttttaggtgccaacctatggaacaga 20 RNA PAT misc_feature 1..20 note HYB_03 (native) source 1..20 mol_type other RNA organism synthetic construct cagcacaaacctctgagcta 20 RNA PAT misc_feature 1..20 note HYB_03 (2O-Me) misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2'-O-methyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct cagcacaaacctctgagcta 20 RNA PAT misc_feature 1..20 note HYB_03 (MOE) misc_feature 1..19 note phosphorothioate nucleotide misc_feature 1..20 note 2-methoxy ethyl modified ribonucleic acid source 1..20 mol_type other RNA organism synthetic construct cagcacaaacctctgagcta 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct gaggaggatgtaaaggtagctca 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct actggcaaacatatcttcatggc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tgcagggtcacaaaaagtgc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct agcactccctgcatttccaa 22 DNA PAT source 1..22 mol_type other DNA organism synthetic construct acaactttggtatcgtggaagg 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct gccatcacgccacagtttc