CN 723001CPCT CN CN202210106396.2 2022-01-28 Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences SMALL RNA AND USE THEREOF IN TREATMENT OF HYPERLIPIDEMIA 77 18 RNA PAT source 1..18 mol_type unassigned RNA organism Artificial Sequence agcagcagcagcagcagc 19 RNA PAT source 1..19 mol_type unassigned RNA organism Artificial Sequence agcagcagcagcagcagca 20 RNA PAT source 1..20 mol_type unassigned RNA organism Artificial Sequence agcagcagcagcagcagcag 18 RNA PAT source 1..18 mol_type unassigned RNA organism Artificial Sequence cagcagcagcagcagcag 19 RNA PAT source 1..19 mol_type unassigned RNA organism Artificial Sequence cagcagcagcagcagcagc 20 RNA PAT source 1..20 mol_type unassigned RNA organism Artificial Sequence cagcagcagcagcagcagca 21 RNA PAT misc_feature 1..21 source 1..21 mol_type unassigned RNA organism Artificial Sequence cagcagcagcagcagcagcag 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-27 source 1..21 mol_type unassigned RNA organism Artificial Sequence tcgacgcgggctctgctcgtt 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-28 source 1..21 mol_type unassigned RNA organism Artificial Sequence ccgtgcgctggattatgactg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-29 source 1..21 mol_type unassigned RNA organism Artificial Sequence tgggcggcattgtctgcggat 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-30 source 1..21 mol_type unassigned RNA organism Artificial Sequence tgcagccccaatcgggcggta 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-31 source 1..21 mol_type unassigned RNA organism Artificial Sequence tgcggctggatcacctccttt 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-32 source 1..21 mol_type unassigned RNA organism Artificial Sequence cgcgcttgactgcgagacaga 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-33 source 1..21 mol_type unassigned RNA organism Artificial Sequence atggctgtcgtcagctcgtgt 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-36 source 1..21 mol_type unassigned RNA organism Artificial Sequence ccggcggactgctcgagctgc 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-39 source 1..21 mol_type unassigned RNA organism Artificial Sequence ctgccggcggactgctcgagc 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-40 source 1..21 mol_type unassigned RNA organism Artificial Sequence cccagccccgaacccgtcggc 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-41 source 1..21 mol_type unassigned RNA organism Artificial Sequence cggctgtcggtggtctgctcg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-55 source 1..21 mol_type unassigned RNA organism Artificial Sequence ggtggctgtagtttagtggta 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-58 source 1..21 mol_type unassigned RNA organism Artificial Sequence agcttcagttgtccgatttgt 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-62 source 1..21 mol_type unassigned RNA organism Artificial Sequence agggctgtagctcagttggta 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-63 source 1..21 mol_type unassigned RNA organism Artificial Sequence cctcggccggatgcggaacgg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-68 source 1..21 mol_type unassigned RNA organism Artificial Sequence ccgaccccgatcttctgtgaa 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-71 source 1..21 mol_type unassigned RNA organism Artificial Sequence gctcgtagttggaccttgggt 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-72 source 1..21 mol_type unassigned RNA organism Artificial Sequence gctcgtagttggaccttggga 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-75 source 1..21 mol_type unassigned RNA organism Artificial Sequence ccctgcgtcgctccgattcgt 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-77 source 1..21 mol_type unassigned RNA organism Artificial Sequence tcttcggaatttgaagctaga 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-79 source 1..21 mol_type unassigned RNA organism Artificial Sequence tcctcgatggtctaacggtca 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-80 source 1..21 mol_type unassigned RNA organism Artificial Sequence cggctgtcggcgaactgctcg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-81 source 1..21 mol_type unassigned RNA organism Artificial Sequence acacggtccagactcctacgg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-82 source 1..21 mol_type unassigned RNA organism Artificial Sequence cgtttcacgtcgggttcacca 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-83 source 1..21 mol_type unassigned RNA organism Artificial Sequence aatggcaccgtaacttcggga 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-84 source 1..21 mol_type unassigned RNA organism Artificial Sequence cggaagccgggttacggtgcc 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-85 source 1..21 mol_type unassigned RNA organism Artificial Sequence cgccgtccgaattgtagtctg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-86 source 1..21 mol_type unassigned RNA organism Artificial Sequence tggctgtcgtcagctcgtgtt 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-87 source 1..21 mol_type unassigned RNA organism Artificial Sequence cggaatccgctaaggactgtg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-88 source 1..21 mol_type unassigned RNA organism Artificial Sequence tgcgcctcggtcggatgtgga 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-90 source 1..21 mol_type unassigned RNA organism Artificial Sequence ctccccatccggcccgtcttg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-91 source 1..21 mol_type unassigned RNA organism Artificial Sequence ccggtgcgttcctgacagtct 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-93 source 1..21 mol_type unassigned RNA organism Artificial Sequence tgcctggcggctgtagcgcgg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-94 source 1..21 mol_type unassigned RNA organism Artificial Sequence cgaatcctggctgttgtatgt 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-95 source 1..21 mol_type unassigned RNA organism Artificial Sequence catgcctgtccgagcgtcatt 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-96 source 1..21 mol_type unassigned RNA organism Artificial Sequence catgcctgttcgagcgtcatt 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-98 source 1..21 mol_type unassigned RNA organism Artificial Sequence atcggctcgggacattgaccg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-99 source 1..21 mol_type unassigned RNA organism Artificial Sequence tattctggtgtcctaggcgta 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-100 source 1..21 mol_type unassigned RNA organism Artificial Sequence ccttcggagtttgaagctaga 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-101 source 1..21 mol_type unassigned RNA organism Artificial Sequence cggactgctcgagctgcttcc 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-102 source 1..21 mol_type unassigned RNA organism Artificial Sequence atgcgagagtagggaactgcc 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-103 source 1..21 mol_type unassigned RNA organism Artificial Sequence cttgactctagtccgactttg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-104 source 1..21 mol_type unassigned RNA organism Artificial Sequence atcgactcggggcgtggaccg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-107 source 1..21 mol_type unassigned RNA organism Artificial Sequence gtggctgtagtttagtggtaa 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-109 source 1..21 mol_type unassigned RNA organism Artificial Sequence gctcgtagttggactttgggt 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-110 source 1..21 mol_type unassigned RNA organism Artificial Sequence gctcgtagttggactttggga 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-111 source 1..21 mol_type unassigned RNA organism Artificial Sequence tcctcgatggtctaacggcta 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-112 source 1..21 mol_type unassigned RNA organism Artificial Sequence cgggctttgcccggtgctctg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-113 source 1..21 mol_type unassigned RNA organism Artificial Sequence tgtgagctcgatgagtagggc 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-114 source 1..21 mol_type unassigned RNA organism Artificial Sequence acacggcccagactcctacgg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-115 source 1..21 mol_type unassigned RNA organism Artificial Sequence gtggagcggtgaaatgcgtag 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-116 source 1..21 mol_type unassigned RNA organism Artificial Sequence cccgtcggctgtcggtggact 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-117 source 1..21 mol_type unassigned RNA organism Artificial Sequence taggtagcgcctcatgtatca 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-118 source 1..21 mol_type unassigned RNA organism Artificial Sequence cgattctcggattggacacca 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-119 source 1..21 mol_type unassigned RNA organism Artificial Sequence ctcactggtcgagtcggcctg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-122 source 1..21 mol_type unassigned RNA organism Artificial Sequence attccggtcctattctgttgg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-123 source 1..21 mol_type unassigned RNA organism Artificial Sequence gtgttgacttcagttttatga 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-124 source 1..21 mol_type unassigned RNA organism Artificial Sequence aggacgtgctaatctgcgaaa 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-125 source 1..21 mol_type unassigned RNA organism Artificial Sequence aaagttgggggctcgaagacg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-126 source 1..21 mol_type unassigned RNA organism Artificial Sequence atgcctgtttgagcgtcattt 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-127 source 1..21 mol_type unassigned RNA organism Artificial Sequence cggctggatcacctcctttct 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-131 source 1..21 mol_type unassigned RNA organism Artificial Sequence cggacaaggggaatccgactg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-132 source 1..21 mol_type unassigned RNA organism Artificial Sequence cgcctcgtgaactcatcttcg 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-135 source 1..21 mol_type unassigned RNA organism Artificial Sequence ccccatgccgcaccgattcgt 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-136 source 1..21 mol_type unassigned RNA organism Artificial Sequence tcctgtactgagctgccccga 21 RNA PAT misc_feature 1..21 note PCSK9-sRNA-137 source 1..21 mol_type unassigned RNA organism Artificial Sequence gcaccggctaactctgtgcca 26 RNA PAT source 1..26 mol_type unassigned RNA organism Artificial Sequence gcctgggcggagcggtcgtcggtgca 21 RNA PAT source 1..21 mol_type unassigned RNA organism Artificial Sequence tgcagccccaatagggcggta 21 DNA PAT source 1..21 mol_type genomic DNA organism Homo sp. ctgctgctgctgctgctgctg 21 DNA PAT source 1..21 mol_type genomic DNA organism Homo sp. ctgctgttgctgctgctgctg