US PUS1230454 CN 202210267054.9 2022-03-18 Beijing Institute of Heart, Lung and Blood Vessel Diseases Beijing Institute of Heart, Lung and Blood Vessel Diseases APTAMER FOR SPECIFICALLY RECOGNIZING SOLUBLE ST2 PROTEIN AND APPLICATION OF THE SAME 13 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct tccatccactcggggctagaagccgtgagaatctg 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct tccatccactcgggccctagggcgtgtatgtccat 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct tccatccactcggcctactaagggtttcgttcacc 36 DNA PAT source 1..36 mol_type other DNA organism synthetic construct tccatccactcggggcgggggctcgtgctctatttc 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct cctccatccactcggcgcaacgccggggctcggcc 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct tccattcactcgaccgctgacgcgggtgtcgtttt 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct tccatgcactcgcccttgaaagggttccctccgtt 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct tccatccactcggcgccacgcggtttctccagatt 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct tccatgcactcgcgctaccggcgtgcccgtagatc 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct tccattcactcgcagcggggtcgcgtgaggcgcaa 75 DNA PAT source 1..75 mol_type other DNA organism synthetic construct gacaggcaggacaccgtaacnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnctgctacctccctcctcttc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct gacaggcaggacaccgtaac 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct gaagaggagggaggtagcag