CN ARG-002WO(02) WO PCT/CN2021/119733 2021-09-23 Shanghai Argo Biopharmaceutical Co.,Ltd. Shanghai Argo Biopharmaceutical Co.,Ltd. Multivalent Ligand Clusters with Diamine Scaffold for Targeted Delivery of Therapeutic Agents 10 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aactcaataaagtgctttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aactcaataaagtgctttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aactcaataaagtgctttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aactcaataaagtgctttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aactcaataaagtgctttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aactcaataaagtgctttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aactcaataaagtgctttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaaagcactttattgagtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatggaaggttatactctaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttagagtataaccttccattc