P244116094SG CN 2022101071901 2022-01-28 Cholesgen (Shanghai) Co., Ltd. STEROID COMPOUND, AND PREPARATION METHOD THEREFOR AND APPLICATION THEREOF 14 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct aactttggcattgtggaagg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ggatgcagggatgatgttct 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct gctgcggaaacttcaggaaat 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct agagacgtgtcactcctggactt 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ccggagaccccttagatcga 26 DNA PAT source 1..26 mol_type other DNA organism synthetic construct tagcctgtaaaagatttctgcaaacc 22 DNA PAT source 1..22 mol_type other DNA organism synthetic construct cttgtggaatgccttgtgattg 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct agccgaagcagcacatgat 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct gccgtgaactgggtcgaa 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct gcatatatagcaatgtctcctgcaa 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct gtccctgaagtcagctgcata 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct tgggacagtccagttcttcat 22 DNA PAT source 1..22 mol_type other DNA organism synthetic construct tgctgacagaggcaccactgaa 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct cagttgtacgtccagaggcatag