EP B33216WO EP EP21206745.8 2021-11-05 BLINK AG A microsphere comprising a first material and a second material 9 24 DNA PAT misc_feature 1..24 note sense primer for mecA source 1..24 mol_type other DNA organism synthetic construct tggcatgagtaacgaagaatataa 21 DNA PAT misc_feature 1..21 note antisense primer for mecA source 1..21 mol_type other DNA organism synthetic construct gagttgaacctggtgaagttg 28 DNA PAT misc_feature 1..28 note TaqMan probe for mecA misc_feature 1 note /note="Atto647N-label" misc_feature 28 note /note="BHQ2 label" source 1..28 mol_type other DNA organism synthetic construct aaagaacctctgctcaacaagttccaga 20 DNA PAT misc_feature 1..20 note sense primer for HCV source 1..20 mol_type other DNA organism synthetic construct gtggtctgcggaaccggtga 22 DNA PAT misc_feature 1..22 note antisense primer for HCV source 1..22 mol_type other DNA organism synthetic construct cgcaagcaccctatcaggcagt 25 DNA PAT misc_feature 1..25 note TaqMan probe for HCV misc_feature 1 note /note="Atto488-label" misc_feature 25 note /note="BHQ1-label" source 1..25 mol_type other DNA organism synthetic construct ccgagtagcgttgggttgcgaaagg 22 DNA PAT misc_feature 1..22 note forward primer for gapA of Staphylococcus aureus misc_feature 1 note /note="desthiobiotin-tag" source 1..22 mol_type other DNA organism synthetic construct cgtcaattagttaaagttgcag 23 DNA PAT misc_feature 1..23 note reverse primer for gapA of Staphylococcus aureus misc_feature 1 note /note="desthiobiotin-tag" source 1..23 mol_type other DNA organism synthetic construct gctaagtatgctaatgtacgaac 31 DNA PAT misc_feature 1..31 note probe for gapA of Staphylococcus aureus misc_feature 1 note /note="desthiobiotin" misc_feature 31 note /note="Cy5-label" source 1..31 mol_type other DNA organism synthetic construct tggtatgataacgaaatgtcatatactgcac