026_BWS-4_WO02 CN PCT/CN2023/123908 2023-10-11 Shanghai Argo Biopharmaceutical Co.,Ltd. aplication name COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF MICROTUBULE ASSOCIATED PROTEIN TAU (MAPT) 2716 6815 RNA PAT source 1..6815 mol_type mRNA organism Homo sapiens gcagtcaccgccacccaccagctccggcaccaacagcagcgccgctgccaccgcccaccttctgccgccgccaccacagccaccttctcctcctccgctgtcctctcccgtcctcgcctctgtcgactatcaggtgaactttgaaccaggatggctgagccccgccaggagttcgaagtgatggaagatcacgctgggacgtacgggttgggggacaggaaagatcaggggggctacaccatgcaccaagaccaagagggtgacacggacgctggcctgaaagaatctcccctgcagacccccactgaggacggatctgaggaaccgggctctgaaacctctgatgctaagagcactccaacagcggaagctgaagaagcaggcattggagacacccccagcctggaagacgaagctgctggtcacgtgacccaagaggagttgagagttccgggccggcagaggaaggcgcctgaaaggcccctggccaatgagattagcgcccacgtccagcctggaccctgcggagaggcctctggggtctctgggccgtgcctcggggagaaagagccagaagctcccgtcccgctgaccgcgagccttcctcagcaccgtcccgtttgcccagcgcctcctccaacaggaggccctcaggagccctccctggagtggggacaaaaaggcggggactgggccgagaagggtccggcctttccgaagcccgccaccactgcgtatctccacacagagcctgaaagtggtaaggtggtccaggaaggcttcctccgagagccaggccccccaggtctgagccaccagctcatgtccggcatgcctggggctcccctcctgcctgagggccccagagaggccacacgccaaccttcggggacaggacctgaggacacagagggcggccgccacgcccctgagctgctcaagcaccagcttctaggagacctgcaccaggaggggccgccgctgaagggggcagggggcaaagagaggccggggagcaaggaggaggtggatgaagaccgcgacgtcgatgagtcctccccccaagactcccctccctccaaggcctccccagcccaagatgggcggcctccccagacagccgccagagaagccaccagcatcccaggcttcccagcggagggtgccatccccctccctgtggatttcctctccaaagtttccacagagatcccagcctcagagcccgacgggcccagtgtagggcgggccaaagggcaggatgcccccctggagttcacgtttcacgtggaaatcacacccaacgtgcagaaggagcaggcgcactcggaggagcatttgggaagggctgcatttccaggggcccctggagaggggccagaggcccggggcccctctttgggagaggacacaaaagaggctgaccttccagagccctctgaaaagcagcctgctgctgctccgcgggggaagcccgtcagccgggtccctcaactcaaagctcgcatggtcagtaaaagcaaagacgggactggaagcgatgacaaaaaagccaagacatccacacgttcctctgctaaaaccttgaaaaataggccttgccttagccccaaacaccccactcctggtagctcagaccctctgatccaaccctccagccctgctgtgtgcccagagccaccttcctctcctaaatacgtctcttctgtcacttcccgaactggcagttctggagcaaaggagatgaaactcaagggggctgatggtaaaacgaagatcgccacaccgcggggagcagcccctccaggccagaagggccaggccaacgccaccaggattccagcaaaaaccccgcccgctccaaagacaccacccagctctggtgaacctccaaaatcaggggatcgcagcggctacagcagccccggctccccaggcactcccggcagccgctcccgcaccccgtcccttccaaccccacccacccgggagcccaagaaggtggcagtggtccgtactccacccaagtcgccgtcttccgccaagagccgcctgcagacagcccccgtgcccatgccagacctgaagaatgtcaagtccaagatcggctccactgagaacctgaagcaccagccgggaggcgggaaggtgcagataattaataagaagctggatcttagcaacgtccagtccaagtgtggctcaaaggataatatcaaacacgtcccgggaggcggcagtgtgcaaatagtctacaaaccagttgacctgagcaaggtgacctccaagtgtggctcattaggcaacatccatcataaaccaggaggtggccaggtggaagtaaaatctgagaagcttgacttcaaggacagagtccagtcgaagattgggtccctggacaatatcacccacgtccctggcggaggaaataaaaagattgaaacccacaagctgaccttccgcgagaacgccaaagccaagacagaccacggggcggagatcgtgtacaagtcgccagtggtgtctggggacacgtctccacggcatctcagcaatgtctcctccaccggcagcatcgacatggtagactcgccccagctcgccacgctagctgacgaggtgtctgcctccctggccaagcagggtttgtgatcaggcccctggggcggtcaataattgtggagaggagagaatgagagagtgtggaaaaaaaaagaataatgacccggcccccgccctctgcccccagctgctcctcgcagttcggttaattggttaatcacttaacctgcttttgtcactcggctttggctcgggacttcaaaatcagtgatgggagtaagagcaaatttcatctttccaaattgatgggtgggctagtaataaaatatttaaaaaaaaacattcaaaaacatggccacatccaacatttcctcaggcaattccttttgattcttttttcttccccctccatgtagaagagggagaaggagaggctctgaaagctgcttctgggggatttcaagggactgggggtgccaaccacctctggccctgttgtgggggtgtcacagaggcagtggcagcaacaaaggatttgaaacttggtgtgttcgtggagccacaggcagacgatgtcaaccttgtgtgagtgtgacgggggttggggtggggcgggaggccacgggggaggccgaggcaggggctgggcagaggggagaggaagcacaagaagtgggagtgggagaggaagccacgtgctggagagtagacatccccctccttgccgctgggagagccaaggcctatgccacctgcagcgtctgagcggccgcctgtccttggtggccgggggtgggggcctgctgtgggtcagtgtgccaccctctgcagggcagcctgtgggagaagggacagcgggtaaaaagagaaggcaagctggcaggagggtggcacttcgtggatgacctccttagaaaagactgaccttgatgtcttgagagcgctggcctcttcctccctccctgcagggtagggggcctgagttgaggggcttccctctgctccacagaaaccctgttttattgagttctgaaggttggaactgctgccatgattttggccactttgcagacctgggactttagggctaaccagttctctttgtaaggacttgtgcctcttgggagacgtccacccgtttccaagcctgggccactggcatctctggagtgtgtgggggtctgggaggcaggtcccgagccccctgtccttcccacggccactgcagtcaccccgtctgcgccgctgtgctgttgtctgccgtgagagcccaatcactgcctatacccctcatcacacgtcacaatgtcccgaattcccagcctcaccaccccttctcagtaatgaccctggttggttgcaggaggtacctactccatactgagggtgaaattaagggaaggcaaagtccaggcacaagagtgggaccccagcctctcactctcagttccactcatccaactgggaccctcaccacgaatctcatgatctgattcggttccctgtctcctcctcccgtcacagatgtgagccagggcactgctcagctgtgaccctaggtgtttctgccttgttgacatggagagagccctttcccctgagaaggcctggccccttcctgtgctgagcccacagcagcaggctgggtgtcttggttgtcagtggtggcaccaggatggaagggcaaggcacccagggcaggcccacagtcccgctgtcccccacttgcaccctagcttgtagctgccaacctcccagacagcccagcccgctgctcagctccacatgcatagtatcagccctccacacccgacaaaggggaacacacccccttggaaatggttcttttcccccagtcccagctggaagccatgctgtctgttctgctggagcagctgaacatatacatagatgttgccctgccctccccatctgcaccctgttgagttgtagttggatttgtctgtttatgcttggattcaccagagtgactatgatagtgaaaagaaaaaaaaaaaaaaaaaaggacgcatgtatcttgaaatgcttgtaaagaggtttctaacccaccctcacgaggtgtctctcacccccacactgggactcgtgtggcctgtgtggtgccaccctgctggggcctcccaagttttgaaaggctttcctcagcacctgggacccaacagagaccagcttctagcagctaaggaggccgttcagctgtgacgaaggcctgaagcacaggattaggactgaagcgatgatgtccccttccctacttccccttggggctccctgtgtcagggcacagactaggtcttgtggctggtctggcttgcggcgcgaggatggttctctctggtcatagcccgaagtctcatggcagtcccaaaggaggcttacaactcctgcatcacaagaaaaaggaagccactgccagctggggggatctgcagctcccagaagctccgtgagcctcagccacccctcagactgggttcctctccaagctcgccctctggaggggcagcgcagcctcccaccaagggccctgcgaccacagcagggattgggatgaattgcctgtcctggatctgctctagaggcccaagctgcctgcctgaggaaggatgacttgacaagtcaggagacactgttcccaaagccttgaccagagcacctcagcccgctgaccttgcacaaactccatctgctgccatgagaaaagggaagccgcctttgcaaaacattgctgcctaaagaaactcagcagcctcaggcccaattctgccacttctggtttgggtacagttaaaggcaaccctgagggacttggcagtagaaatccagggcctcccctggggctggcagcttcgtgtgcagctagagctttacctgaaaggaagtctctgggcccagaactctccaccaagagcctccctgccgttcgctgagtcccagcaattctcctaagttgaagggatctgagaaggagaaggaaatgtggggtagatttggtggtggttagagatatgcccccctcattactgccaacagtttcggctgcatttcttcacgcacctcggttcctcttcctgaagttcttgtgccctgctcttcagcaccatgggccttcttatacggaaggctctgggatctcccccttgtggggcaggctcttggggccagcctaagatcatggtttagggtgatcagtgctggcagataaattgaaaaggcacgctggcttgtgatcttaaatgaggacaatccccccagggctgggcactcctcccctcccctcacttctcccacctgcagagccagtgtccttgggtgggctagataggatatactgtatgccggctccttcaagctgctgactcactttatcaatagttccatttaaattgacttcagtggtgagactgtatcctgtttgctattgcttgttgtgctatggggggaggggggaggaatgtgtaagatagttaacatgggcaaagggagatcttggggtgcagcacttaaactgcctcgtaacccttttcatgatttcaaccacatttgctagagggagggagcagccacggagttagaggcccttggggtttctcttttccactgacaggctttcccaggcagctggctagttcattccctccccagccaggtgcaggcgtaggaatatggacatctggttgctttggcctgctgccctctttcaggggtcctaagcccacaatcatgcctccctaagaccttggcatccttccctctaagccgttggcacctctgtgccacctctcacactggctccagacacacagcctgtgcttttggagctgagatcactcgcttcaccctcctcatctttgttctccaagtaaagccacgaggtcggggcgagggcagaggtgatcacctgcgtgtcccatctacagacctgcagcttcataaaacttctgatttctcttcagctttgaaaagggttaccctgggcactggcctagagcctcacctcctaatagacttagccccatgagtttgccatgttgagcaggactatttctggcacttgcaagtcccatgatttcttcggtaattctgagggtggggggagggacatgaaatcatcttagcttagctttctgtctgtgaatgtctatatagtgtattgtgtgttttaacaaatgatttacactgactgttgctgtaaaagtgaatttggaaataaagttattactctgattaaa 6815 RNA PAT source 1..6815 mol_type mRNA organism Homo sapiens tttaatcagagtaataactttatttccaaattcacttttacagcaacagtcagtgtaaatcatttgttaaaacacacaatacactatatagacattcacagacagaaagctaagctaagatgatttcatgtccctccccccaccctcagaattaccgaagaaatcatgggacttgcaagtgccagaaatagtcctgctcaacatggcaaactcatggggctaagtctattaggaggtgaggctctaggccagtgcccagggtaacccttttcaaagctgaagagaaatcagaagttttatgaagctgcaggtctgtagatgggacacgcaggtgatcacctctgccctcgccccgacctcgtggctttacttggagaacaaagatgaggagggtgaagcgagtgatctcagctccaaaagcacaggctgtgtgtctggagccagtgtgagaggtggcacagaggtgccaacggcttagagggaaggatgccaaggtcttagggaggcatgattgtgggcttaggacccctgaaagagggcagcaggccaaagcaaccagatgtccatattcctacgcctgcacctggctggggagggaatgaactagccagctgcctgggaaagcctgtcagtggaaaagagaaaccccaagggcctctaactccgtggctgctccctccctctagcaaatgtggttgaaatcatgaaaagggttacgaggcagtttaagtgctgcaccccaagatctccctttgcccatgttaactatcttacacattcctcccccctccccccatagcacaacaagcaatagcaaacaggatacagtctcaccactgaagtcaatttaaatggaactattgataaagtgagtcagcagcttgaaggagccggcatacagtatatcctatctagcccacccaaggacactggctctgcaggtgggagaagtgaggggaggggaggagtgcccagccctggggggattgtcctcatttaagatcacaagccagcgtgccttttcaatttatctgccagcactgatcaccctaaaccatgatcttaggctggccccaagagcctgccccacaagggggagatcccagagccttccgtataagaaggcccatggtgctgaagagcagggcacaagaacttcaggaagaggaaccgaggtgcgtgaagaaatgcagccgaaactgttggcagtaatgaggggggcatatctctaaccaccaccaaatctaccccacatttccttctccttctcagatcccttcaacttaggagaattgctgggactcagcgaacggcagggaggctcttggtggagagttctgggcccagagacttcctttcaggtaaagctctagctgcacacgaagctgccagccccaggggaggccctggatttctactgccaagtccctcagggttgcctttaactgtacccaaaccagaagtggcagaattgggcctgaggctgctgagtttctttaggcagcaatgttttgcaaaggcggcttcccttttctcatggcagcagatggagtttgtgcaaggtcagcgggctgaggtgctctggtcaaggctttgggaacagtgtctcctgacttgtcaagtcatccttcctcaggcaggcagcttgggcctctagagcagatccaggacaggcaattcatcccaatccctgctgtggtcgcagggcccttggtgggaggctgcgctgcccctccagagggcgagcttggagaggaacccagtctgaggggtggctgaggctcacggagcttctgggagctgcagatccccccagctggcagtggcttcctttttcttgtgatgcaggagttgtaagcctcctttgggactgccatgagacttcgggctatgaccagagagaaccatcctcgcgccgcaagccagaccagccacaagacctagtctgtgccctgacacagggagccccaaggggaagtagggaaggggacatcatcgcttcagtcctaatcctgtgcttcaggccttcgtcacagctgaacggcctccttagctgctagaagctggtctctgttgggtcccaggtgctgaggaaagcctttcaaaacttgggaggccccagcagggtggcaccacacaggccacacgagtcccagtgtgggggtgagagacacctcgtgagggtgggttagaaacctctttacaagcatttcaagatacatgcgtccttttttttttttttttttcttttcactatcatagtcactctggtgaatccaagcataaacagacaaatccaactacaactcaacagggtgcagatggggagggcagggcaacatctatgtatatgttcagctgctccagcagaacagacagcatggcttccagctgggactgggggaaaagaaccatttccaagggggtgtgttcccctttgtcgggtgtggagggctgatactatgcatgtggagctgagcagcgggctgggctgtctgggaggttggcagctacaagctagggtgcaagtgggggacagcgggactgtgggcctgccctgggtgccttgcccttccatcctggtgccaccactgacaaccaagacacccagcctgctgctgtgggctcagcacaggaaggggccaggccttctcaggggaaagggctctctccatgtcaacaaggcagaaacacctagggtcacagctgagcagtgccctggctcacatctgtgacgggaggaggagacagggaaccgaatcagatcatgagattcgtggtgagggtcccagttggatgagtggaactgagagtgagaggctggggtcccactcttgtgcctggactttgccttcccttaatttcaccctcagtatggagtaggtacctcctgcaaccaaccagggtcattactgagaaggggtggtgaggctgggaattcgggacattgtgacgtgtgatgaggggtataggcagtgattgggctctcacggcagacaacagcacagcggcgcagacggggtgactgcagtggccgtgggaaggacagggggctcgggacctgcctcccagacccccacacactccagagatgccagtggcccaggcttggaaacgggtggacgtctcccaagaggcacaagtccttacaaagagaactggttagccctaaagtcccaggtctgcaaagtggccaaaatcatggcagcagttccaaccttcagaactcaataaaacagggtttctgtggagcagagggaagcccctcaactcaggccccctaccctgcagggagggaggaagaggccagcgctctcaagacatcaaggtcagtcttttctaaggaggtcatccacgaagtgccaccctcctgccagcttgccttctctttttacccgctgtcccttctcccacaggctgccctgcagagggtggcacactgacccacagcaggcccccacccccggccaccaaggacaggcggccgctcagacgctgcaggtggcataggccttggctctcccagcggcaaggagggggatgtctactctccagcacgtggcttcctctcccactcccacttcttgtgcttcctctcccctctgcccagcccctgcctcggcctcccccgtggcctcccgccccaccccaacccccgtcacactcacacaaggttgacatcgtctgcctgtggctccacgaacacaccaagtttcaaatcctttgttgctgccactgcctctgtgacacccccacaacagggccagaggtggttggcacccccagtcccttgaaatcccccagaagcagctttcagagcctctccttctccctcttctacatggagggggaagaaaaaagaatcaaaaggaattgcctgaggaaatgttggatgtggccatgtttttgaatgtttttttttaaatattttattactagcccacccatcaatttggaaagatgaaatttgctcttactcccatcactgattttgaagtcccgagccaaagccgagtgacaaaagcaggttaagtgattaaccaattaaccgaactgcgaggagcagctgggggcagagggcgggggccgggtcattattctttttttttccacactctctcattctctcctctccacaattattgaccgccccaggggcctgatcacaaaccctgcttggccagggaggcagacacctcgtcagctagcgtggcgagctggggcgagtctaccatgtcgatgctgccggtggaggagacattgctgagatgccgtggagacgtgtccccagacaccactggcgacttgtacacgatctccgccccgtggtctgtcttggctttggcgttctcgcggaaggtcagcttgtgggtttcaatctttttatttcctccgccagggacgtgggtgatattgtccagggacccaatcttcgactggactctgtccttgaagtcaagcttctcagattttacttccacctggccacctcctggtttatgatggatgttgcctaatgagccacacttggaggtcaccttgctcaggtcaactggtttgtagactatttgcacactgccgcctcccgggacgtgtttgatattatcctttgagccacacttggactggacgttgctaagatccagcttcttattaattatctgcaccttcccgcctcccggctggtgcttcaggttctcagtggagccgatcttggacttgacattcttcaggtctggcatgggcacgggggctgtctgcaggcggctcttggcggaagacggcgacttgggtggagtacggaccactgccaccttcttgggctcccgggtgggtggggttggaagggacggggtgcgggagcggctgccgggagtgcctggggagccggggctgctgtagccgctgcgatcccctgattttggaggttcaccagagctgggtggtgtctttggagcgggcggggtttttgctggaatcctggtggcgttggcctggcccttctggcctggaggggctgctccccgcggtgtggcgatcttcgttttaccatcagcccccttgagtttcatctcctttgctccagaactgccagttcgggaagtgacagaagagacgtatttaggagaggaaggtggctctgggcacacagcagggctggagggttggatcagagggtctgagctaccaggagtggggtgtttggggctaaggcaaggcctatttttcaaggttttagcagaggaacgtgtggatgtcttggcttttttgtcatcgcttccagtcccgtctttgcttttactgaccatgcgagctttgagttgagggacccggctgacgggcttcccccgcggagcagcagcaggctgcttttcagagggctctggaaggtcagcctcttttgtgtcctctcccaaagaggggccccgggcctctggcccctctccaggggcccctggaaatgcagcccttcccaaatgctcctccgagtgcgcctgctccttctgcacgttgggtgtgatttccacgtgaaacgtgaactccaggggggcatcctgccctttggcccgccctacactgggcccgtcgggctctgaggctgggatctctgtggaaactttggagaggaaatccacagggagggggatggcaccctccgctgggaagcctgggatgctggtggcttctctggcggctgtctggggaggccgcccatcttgggctggggaggccttggagggaggggagtcttggggggaggactcatcgacgtcgcggtcttcatccacctcctccttgctccccggcctctctttgccccctgcccccttcagcggcggcccctcctggtgcaggtctcctagaagctggtgcttgagcagctcaggggcgtggcggccgccctctgtgtcctcaggtcctgtccccgaaggttggcgtgtggcctctctggggccctcaggcaggaggggagccccaggcatgccggacatgagctggtggctcagacctggggggcctggctctcggaggaagccttcctggaccaccttaccactttcaggctctgtgtggagatacgcagtggtggcgggcttcggaaaggccggacccttctcggcccagtccccgcctttttgtccccactccagggagggctcctgagggcctcctgttggaggaggcgctgggcaaacgggacggtgctgaggaaggctcgcggtcagcgggacgggagcttctggctctttctccccgaggcacggcccagagaccccagaggcctctccgcagggtccaggctggacgtgggcgctaatctcattggccaggggcctttcaggcgccttcctctgccggcccggaactctcaactcctcttgggtcacgtgaccagcagcttcgtcttccaggctgggggtgtctccaatgcctgcttcttcagcttccgctgttggagtgctcttagcatcagaggtttcagagcccggttcctcagatccgtcctcagtgggggtctgcaggggagattctttcaggccagcgtccgtgtcaccctcttggtcttggtgcatggtgtagcccccctgatctttcctgtcccccaacccgtacgtcccagcgtgatcttccatcacttcgaactcctggcggggctcagccatcctggttcaaagttcacctgatagtcgacagaggcgaggacgggagaggacagcggaggaggagaaggtggctgtggtggcggcggcagaaggtgggcggtggcagcggcgctgctgttggtgccggagctggtgggtggcggtgactgc 5372 RNA PAT source 1..5372 mol_type mRNA organism Homo sapiens gcagtcaccgccacccaccagctccggcaccaacagcagcgccgctgccaccgcccaccttctgccgccgccaccacagccaccttctcctcctccgctgtcctctcccgtcctcgcctctgtcgactatcaggtgaactttgaaccaggatggctgagccccgccaggagttcgaagtgatggaagatcacgctgggacgtacgggttgggggacaggaaagatcaggggggctacaccatgcaccaagaccaagagggtgacacggacgctggcctgaaagctgaagaagcaggcattggagacacccccagcctggaagacgaagctgctggtcacgtgacccaagctcgcatggtcagtaaaagcaaagacgggactggaagcgatgacaaaaaagccaagggggctgatggtaaaacgaagatcgccacaccgcggggagcagcccctccaggccagaagggccaggccaacgccaccaggattccagcaaaaaccccgcccgctccaaagacaccacccagctctggtgaacctccaaaatcaggggatcgcagcggctacagcagccccggctccccaggcactcccggcagccgctcccgcaccccgtcccttccaaccccacccacccgggagcccaagaaggtggcagtggtccgtactccacccaagtcgccgtcttccgccaagagccgcctgcagacagcccccgtgcccatgccagacctgaagaatgtcaagtccaagatcggctccactgagaacctgaagcaccagccgggaggcgggaaggtgcaaatagtctacaaaccagttgacctgagcaaggtgacctccaagtgtggctcattaggcaacatccatcataaaccaggaggtggccaggtggaagtaaaatctgagaagcttgacttcaaggacagagtccagtcgaagattgggtccctggacaatatcacccacgtccctggcggaggaaataaaaagattgaaacccacaagctgaccttccgcgagaacgccaaagccaagacagaccacggggcggagatcgtgtacaagtcgccagtggtgtctggggacacgtctccacggcatctcagcaatgtctcctccaccggcagcatcgacatggtagactcgccccagctcgccacgctagctgacgaggtgtctgcctccctggccaagcagggtttgtgatcaggcccctggggcggtcaataattgtggagaggagagaatgagagagtgtggaaaaaaaaagaataatgacccggcccccgccctctgcccccagctgctcctcgcagttcggttaattggttaatcacttaacctgcttttgtcactcggctttggctcgggacttcaaaatcagtgatgggagtaagagcaaatttcatctttccaaattgatgggtgggctagtaataaaatatttaaaaaaaaacattcaaaaacatggccacatccaacatttcctcaggcaattccttttgattcttttttcttccccctccatgtagaagagggagaaggagaggctctgaaagctgcttctgggggatttcaagggactgggggtgccaaccacctctggccctgttgtgggggtgtcacagaggcagtggcagcaacaaaggatttgaaacttggtgtgttcgtggagccacaggcagacgatgtcaaccttgtgtgagtgtgacgggggttggggtggggcgggaggccacgggggaggccgaggcaggggctgggcagaggggagaggaagcacaagaagtgggagtgggagaggaagccacgtgctggagagtagacatccccctccttgccgctgggagagccaaggcctatgccacctgcagcgtctgagcggccgcctgtccttggtggccgggggtgggggcctgctgtgggtcagtgtgccaccctctgcagggcagcctgtgggagaagggacagcgggtaaaaagagaaggcaagctggcaggagggtggcacttcgtggatgacctccttagaaaagactgaccttgatgtcttgagagcgctggcctcttcctccctccctgcagggtagggggcctgagttgaggggcttccctctgctccacagaaaccctgttttattgagttctgaaggttggaactgctgccatgattttggccactttgcagacctgggactttagggctaaccagttctctttgtaaggacttgtgcctcttgggagacgtccacccgtttccaagcctgggccactggcatctctggagtgtgtgggggtctgggaggcaggtcccgagccccctgtccttcccacggccactgcagtcaccccgtctgcgccgctgtgctgttgtctgccgtgagagcccaatcactgcctatacccctcatcacacgtcacaatgtcccgaattcccagcctcaccaccccttctcagtaatgaccctggttggttgcaggaggtacctactccatactgagggtgaaattaagggaaggcaaagtccaggcacaagagtgggaccccagcctctcactctcagttccactcatccaactgggaccctcaccacgaatctcatgatctgattcggttccctgtctcctcctcccgtcacagatgtgagccagggcactgctcagctgtgaccctaggtgtttctgccttgttgacatggagagagccctttcccctgagaaggcctggccccttcctgtgctgagcccacagcagcaggctgggtgtcttggttgtcagtggtggcaccaggatggaagggcaaggcacccagggcaggcccacagtcccgctgtcccccacttgcaccctagcttgtagctgccaacctcccagacagcccagcccgctgctcagctccacatgcatagtatcagccctccacacccgacaaaggggaacacacccccttggaaatggttcttttcccccagtcccagctggaagccatgctgtctgttctgctggagcagctgaacatatacatagatgttgccctgccctccccatctgcaccctgttgagttgtagttggatttgtctgtttatgcttggattcaccagagtgactatgatagtgaaaagaaaaaaaaaaaaaaaaaaggacgcatgtatcttgaaatgcttgtaaagaggtttctaacccaccctcacgaggtgtctctcacccccacactgggactcgtgtggcctgtgtggtgccaccctgctggggcctcccaagttttgaaaggctttcctcagcacctgggacccaacagagaccagcttctagcagctaaggaggccgttcagctgtgacgaaggcctgaagcacaggattaggactgaagcgatgatgtccccttccctacttccccttggggctccctgtgtcagggcacagactaggtcttgtggctggtctggcttgcggcgcgaggatggttctctctggtcatagcccgaagtctcatggcagtcccaaaggaggcttacaactcctgcatcacaagaaaaaggaagccactgccagctggggggatctgcagctcccagaagctccgtgagcctcagccacccctcagactgggttcctctccaagctcgccctctggaggggcagcgcagcctcccaccaagggccctgcgaccacagcagggattgggatgaattgcctgtcctggatctgctctagaggcccaagctgcctgcctgaggaaggatgacttgacaagtcaggagacactgttcccaaagccttgaccagagcacctcagcccgctgaccttgcacaaactccatctgctgccatgagaaaagggaagccgcctttgcaaaacattgctgcctaaagaaactcagcagcctcaggcccaattctgccacttctggtttgggtacagttaaaggcaaccctgagggacttggcagtagaaatccagggcctcccctggggctggcagcttcgtgtgcagctagagctttacctgaaaggaagtctctgggcccagaactctccaccaagagcctccctgccgttcgctgagtcccagcaattctcctaagttgaagggatctgagaaggagaaggaaatgtggggtagatttggtggtggttagagatatgcccccctcattactgccaacagtttcggctgcatttcttcacgcacctcggttcctcttcctgaagttcttgtgccctgctcttcagcaccatgggccttcttatacggaaggctctgggatctcccccttgtggggcaggctcttggggccagcctaagatcatggtttagggtgatcagtgctggcagataaattgaaaaggcacgctggcttgtgatcttaaatgaggacaatccccccagggctgggcactcctcccctcccctcacttctcccacctgcagagccagtgtccttgggtgggctagataggatatactgtatgccggctccttcaagctgctgactcactttatcaatagttccatttaaattgacttcagtggtgagactgtatcctgtttgctattgcttgttgtgctatggggggaggggggaggaatgtgtaagatagttaacatgggcaaagggagatcttggggtgcagcacttaaactgcctcgtaacccttttcatgatttcaaccacatttgctagagggagggagcagccacggagttagaggcccttggggtttctcttttccactgacaggctttcccaggcagctggctagttcattccctccccagccaggtgcaggcgtaggaatatggacatctggttgctttggcctgctgccctctttcaggggtcctaagcccacaatcatgcctccctaagaccttggcatccttccctctaagccgttggcacctctgtgccacctctcacactggctccagacacacagcctgtgcttttggagctgagatcactcgcttcaccctcctcatctttgttctccaagtaaagccacgaggtcggggcgagggcagaggtgatcacctgcgtgtcccatctacagacctgcagcttcataaaacttctgatttctcttcagctttgaaaagggttaccctgggcactggcctagagcctcacctcctaatagacttagccccatgagtttgccatgttgagcaggactatttctggcacttgcaagtcccatgatttcttcggtaattctgagggtggggggagggacatgaaatcatcttagcttagctttctgtctgtgaatgtctatatagtgtattgtgtgttttaacaaatgatttacactgactgttgctgtaaaagtgaatttggaaataaagttattactctgattaaa 5372 RNA PAT source 1..5372 mol_type mRNA organism Homo sapiens tttaatcagagtaataactttatttccaaattcacttttacagcaacagtcagtgtaaatcatttgttaaaacacacaatacactatatagacattcacagacagaaagctaagctaagatgatttcatgtccctccccccaccctcagaattaccgaagaaatcatgggacttgcaagtgccagaaatagtcctgctcaacatggcaaactcatggggctaagtctattaggaggtgaggctctaggccagtgcccagggtaacccttttcaaagctgaagagaaatcagaagttttatgaagctgcaggtctgtagatgggacacgcaggtgatcacctctgccctcgccccgacctcgtggctttacttggagaacaaagatgaggagggtgaagcgagtgatctcagctccaaaagcacaggctgtgtgtctggagccagtgtgagaggtggcacagaggtgccaacggcttagagggaaggatgccaaggtcttagggaggcatgattgtgggcttaggacccctgaaagagggcagcaggccaaagcaaccagatgtccatattcctacgcctgcacctggctggggagggaatgaactagccagctgcctgggaaagcctgtcagtggaaaagagaaaccccaagggcctctaactccgtggctgctccctccctctagcaaatgtggttgaaatcatgaaaagggttacgaggcagtttaagtgctgcaccccaagatctccctttgcccatgttaactatcttacacattcctcccccctccccccatagcacaacaagcaatagcaaacaggatacagtctcaccactgaagtcaatttaaatggaactattgataaagtgagtcagcagcttgaaggagccggcatacagtatatcctatctagcccacccaaggacactggctctgcaggtgggagaagtgaggggaggggaggagtgcccagccctggggggattgtcctcatttaagatcacaagccagcgtgccttttcaatttatctgccagcactgatcaccctaaaccatgatcttaggctggccccaagagcctgccccacaagggggagatcccagagccttccgtataagaaggcccatggtgctgaagagcagggcacaagaacttcaggaagaggaaccgaggtgcgtgaagaaatgcagccgaaactgttggcagtaatgaggggggcatatctctaaccaccaccaaatctaccccacatttccttctccttctcagatcccttcaacttaggagaattgctgggactcagcgaacggcagggaggctcttggtggagagttctgggcccagagacttcctttcaggtaaagctctagctgcacacgaagctgccagccccaggggaggccctggatttctactgccaagtccctcagggttgcctttaactgtacccaaaccagaagtggcagaattgggcctgaggctgctgagtttctttaggcagcaatgttttgcaaaggcggcttcccttttctcatggcagcagatggagtttgtgcaaggtcagcgggctgaggtgctctggtcaaggctttgggaacagtgtctcctgacttgtcaagtcatccttcctcaggcaggcagcttgggcctctagagcagatccaggacaggcaattcatcccaatccctgctgtggtcgcagggcccttggtgggaggctgcgctgcccctccagagggcgagcttggagaggaacccagtctgaggggtggctgaggctcacggagcttctgggagctgcagatccccccagctggcagtggcttcctttttcttgtgatgcaggagttgtaagcctcctttgggactgccatgagacttcgggctatgaccagagagaaccatcctcgcgccgcaagccagaccagccacaagacctagtctgtgccctgacacagggagccccaaggggaagtagggaaggggacatcatcgcttcagtcctaatcctgtgcttcaggccttcgtcacagctgaacggcctccttagctgctagaagctggtctctgttgggtcccaggtgctgaggaaagcctttcaaaacttgggaggccccagcagggtggcaccacacaggccacacgagtcccagtgtgggggtgagagacacctcgtgagggtgggttagaaacctctttacaagcatttcaagatacatgcgtccttttttttttttttttttcttttcactatcatagtcactctggtgaatccaagcataaacagacaaatccaactacaactcaacagggtgcagatggggagggcagggcaacatctatgtatatgttcagctgctccagcagaacagacagcatggcttccagctgggactgggggaaaagaaccatttccaagggggtgtgttcccctttgtcgggtgtggagggctgatactatgcatgtggagctgagcagcgggctgggctgtctgggaggttggcagctacaagctagggtgcaagtgggggacagcgggactgtgggcctgccctgggtgccttgcccttccatcctggtgccaccactgacaaccaagacacccagcctgctgctgtgggctcagcacaggaaggggccaggccttctcaggggaaagggctctctccatgtcaacaaggcagaaacacctagggtcacagctgagcagtgccctggctcacatctgtgacgggaggaggagacagggaaccgaatcagatcatgagattcgtggtgagggtcccagttggatgagtggaactgagagtgagaggctggggtcccactcttgtgcctggactttgccttcccttaatttcaccctcagtatggagtaggtacctcctgcaaccaaccagggtcattactgagaaggggtggtgaggctgggaattcgggacattgtgacgtgtgatgaggggtataggcagtgattgggctctcacggcagacaacagcacagcggcgcagacggggtgactgcagtggccgtgggaaggacagggggctcgggacctgcctcccagacccccacacactccagagatgccagtggcccaggcttggaaacgggtggacgtctcccaagaggcacaagtccttacaaagagaactggttagccctaaagtcccaggtctgcaaagtggccaaaatcatggcagcagttccaaccttcagaactcaataaaacagggtttctgtggagcagagggaagcccctcaactcaggccccctaccctgcagggagggaggaagaggccagcgctctcaagacatcaaggtcagtcttttctaaggaggtcatccacgaagtgccaccctcctgccagcttgccttctctttttacccgctgtcccttctcccacaggctgccctgcagagggtggcacactgacccacagcaggcccccacccccggccaccaaggacaggcggccgctcagacgctgcaggtggcataggccttggctctcccagcggcaaggagggggatgtctactctccagcacgtggcttcctctcccactcccacttcttgtgcttcctctcccctctgcccagcccctgcctcggcctcccccgtggcctcccgccccaccccaacccccgtcacactcacacaaggttgacatcgtctgcctgtggctccacgaacacaccaagtttcaaatcctttgttgctgccactgcctctgtgacacccccacaacagggccagaggtggttggcacccccagtcccttgaaatcccccagaagcagctttcagagcctctccttctccctcttctacatggagggggaagaaaaaagaatcaaaaggaattgcctgaggaaatgttggatgtggccatgtttttgaatgtttttttttaaatattttattactagcccacccatcaatttggaaagatgaaatttgctcttactcccatcactgattttgaagtcccgagccaaagccgagtgacaaaagcaggttaagtgattaaccaattaaccgaactgcgaggagcagctgggggcagagggcgggggccgggtcattattctttttttttccacactctctcattctctcctctccacaattattgaccgccccaggggcctgatcacaaaccctgcttggccagggaggcagacacctcgtcagctagcgtggcgagctggggcgagtctaccatgtcgatgctgccggtggaggagacattgctgagatgccgtggagacgtgtccccagacaccactggcgacttgtacacgatctccgccccgtggtctgtcttggctttggcgttctcgcggaaggtcagcttgtgggtttcaatctttttatttcctccgccagggacgtgggtgatattgtccagggacccaatcttcgactggactctgtccttgaagtcaagcttctcagattttacttccacctggccacctcctggtttatgatggatgttgcctaatgagccacacttggaggtcaccttgctcaggtcaactggtttgtagactatttgcaccttcccgcctcccggctggtgcttcaggttctcagtggagccgatcttggacttgacattcttcaggtctggcatgggcacgggggctgtctgcaggcggctcttggcggaagacggcgacttgggtggagtacggaccactgccaccttcttgggctcccgggtgggtggggttggaagggacggggtgcgggagcggctgccgggagtgcctggggagccggggctgctgtagccgctgcgatcccctgattttggaggttcaccagagctgggtggtgtctttggagcgggcggggtttttgctggaatcctggtggcgttggcctggcccttctggcctggaggggctgctccccgcggtgtggcgatcttcgttttaccatcagcccccttggcttttttgtcatcgcttccagtcccgtctttgcttttactgaccatgcgagcttgggtcacgtgaccagcagcttcgtcttccaggctgggggtgtctccaatgcctgcttcttcagctttcaggccagcgtccgtgtcaccctcttggtcttggtgcatggtgtagcccccctgatctttcctgtcccccaacccgtacgtcccagcgtgatcttccatcacttcgaactcctggcggggctcagccatcctggttcaaagttcacctgatagtcgacagaggcgaggacgggagaggacagcggaggaggagaaggtggctgtggtggcggcggcagaaggtgggcggtggcagcggcgctgctgttggtgccggagctggtgggtggcggtgactgc 5338 RNA PAT source 1..5338 mol_type mRNA organism Mus musculus agtctccgccacccaccagctccagcaccagcagcagcgccgccgccaccgcccaccttctgccgccgccgccacaaccaccttctcctccgctgtcctcttctgtcctcgccttctgtcgattatcaggctttgaaccagtatggctgaccctcgccaggagtttgacacaatggaagaccatgctggagattacactctgctccaagaccaagaaggagacatggaccatggcttaaaagagtctcccccacagccccccgccgatgatggagcggaggaaccagggtcggagacctccgatgctaagagcactccaactgctgaagacgtgactgcgcccctagtggatgagagagctcccgacaagcaggccgctgcccagccccacacggagatcccagaaggaattacagccgaagaagcaggcatcggagacaccccgaaccaggaggaccaagccgctgggcatgtgactcaagctcgtgtggccagcaaagacaggacaggaaatgacgagaagaaagccaagggcgctgatggcaaaaccggggcgaagatcgccacacctcggggagcagcctctccggcccagaagggcacgtccaacgccaccaggatcccggccaagaccacgcccagccctaagactcctccagggtcaggtgaaccaccaaaatccggagaacgaagcggctacagcagccccggctctcccggaacgcctggcagtcgctcgcgcaccccatccctaccaacaccgcccacccgggagcccaagaaggtggcagtggtccgcactccccctaagtcaccatcagctagtaagagccgcctgcagactgcccctgtgcccatgccagacctaaagaatgtcaggtcgaagattggctctactgagaacctgaagcaccagccaggaggtggcaaggtgcagataattaataagaagctggatcttagcaacgtccagtccaagtgtggctcgaaggataatatcaaacacgtcccgggtggaggcagtgtgcaaatagtctacaagccggtggacctgagcaaagtgacctccaagtgtggctcgttagggaacatccatcacaagccaggaggtggccaggtggaagtaaaatcagagaagctggacttcaaggacagagtccagtcgaagattggctccttggataatatcacccacgtccctggaggagggaataagaagattgaaacccacaagctgaccttcagggagaatgccaaagccaagacagaccatggagcagaaattgtgtataagtcacccgtggtgtctggggacacatctccacggcacctcagcaatgtgtcttccacgggcagcatcgacatggtggactcaccacagcttgccacactagccgatgaagtgtctgcttccttggccaagcagggtttgtgatcaggctcccagggcagtcaataatcatggagagaagagagagtgagagtgtggaaaaaaaaaaaaaaaaagaatgatctggccccttgccctctgccctccccgctgctcctcatagacaggctgacctgcttgtcacctaacctgcttttgtggctcggatttggctcgggacttcaaaatcagtgatgggaaaagtacatttcatctttccaaattgatttgtgggctaaaaataaaacatatttaagggaaaaaaaaacatgtaaaaacatggccaaaaaatttccttgggcaattgctaattgatttcccccccctgaccccgccctccctctctgagtattagagggtgaagaaggctctggaggctgcttctggggagtggctgagggactagggcagctaattgcccatagccccatcctaggggcttcagggacagtggcagcaatgagagatttgagacttggtgtgttcgtggggccgtaggcaggtgctgttaacttgtgtgggtgtgagtggggactgaaacagcgacagcgaaggctgagagatggatgggtggactgagttagaggacagaggtgaggaaggcaggttgggagaggggacactggctccttgccaagtagcttggggaggacagggtgctgcagctgcctgcagcagtcctagctagctcagatgcctgcttgataaagcactgtgggggtaacgtgggtgtgtgtgccccttctgcagggcagcctgtgggagaaggggtattgggcagaaggaaggtaagccagcaggtggtaccttgtagattggttctcttgaaggctgctcttgacatcccagggcactggcttcttcctccctccccgcaaggtgggaggtcctgagcgaggtgtttcccttcgctcccacaggaaaagctgctttactgagttctcaagtttggaactacagccatgatttggccaccattacagacctgggactttagggctaaccagatctttgtaaggacttgtgcctcttgggggacctctgcctgttctcatgcttggccctctggcacttctgtagtgggagggatggggggtggtattctgggatgtgggtcccaggcctcccatccctcacacagccactgtatcccctctctctgtcctatcatgcccacgtctgccacgagagctagtcactgccgtccgtacatcacgtctcactgtcctgagtgccatgcctctcccagcccccatccctggcccctgggtagatatgggcaatatctgctctacactaggggttggagtccagggaaggcaaagatttgggcctcagtctctagtcctacgttccacgaatccaaccagtgtgcctcccacaaggaaccttacgaccttgtttggttcactccattacttcctatcctggatgggaactggtgtgtgcctgcctggggatgaccttggacctctgccttttcttttatctaagtggatgcctcctaggcctgactccttgtgttgagctggaggcagccaagtcaggtgccaatgtcttggcatcagtaagaacagtcaagagtcccagggcagggccacacttctcccatctttcgcttccaccccagcttgtgatcgctagcctcccagagctcagctgccattaagtccccatgcacgtaatcagtctccacaccccagtttggggaacatacccccttgattgaagtgtttttttcctccggtcccatggaaaccatgctgcctgccctgctggagcagacggccacctccatagatgcagccctttctttcccgtcttcgccctgttacgttgtagttggatttgtctgtttgtctgggttcaccagagtgactatgatagtgaaaagaaaagaaagaaaaagaaaaaaaaaaaaaaaaagaaaaagaaaaaggaaaaaaaaaaggacgcatgtatcttgaaatatttgtcaaaaggttctagcccaccacgtgatggagagtctggatatctccttcctgacgtggctccaggccagtgcagtgctaacctgctgggacatcccatgttttgaagggtttcttctgcatctgggacctcacagacactggattgtgacattggaggtctgtgacattggaggtcaatggcattggccaaggcctgaagcacaggaccagctagaggcagcaggctccgagtgccagggagagcttgtggctggcctgttttgtatgaagatggtcctttctgatcacgacttcaaatcccacagtagccctgaaagacatctaagaactcctgcatcacaagagaaaaggacaccagtaccagcagggagagctgtgaccctagaaattccatgacgacccagtagatatccttgggccctctccaagcctgggccttttcaccatagagtttgggatggactgtcccactgatgaaggggacatcttaggagactcccttggtttccaagctgtcagccccctgaacttgcacgacctcctacagcttcagggactaggcctttgaagattaggaacctcaggcccacatcagccacttctgatgtacagttaaggacaatgtggagactaggaggaagcagccagcctttcccattaaagaactcttgagtgcccagggctacctattgtgagcttccccactgataagactttagctgtccatagaagtgagtccgagggaggaaaagtgtggtttcttcatcatggttacctgtcgtggttctctctcttacacccatttacccatcccgcagttcctgtccttgaatggggggtggggtgctctgcctatctcttgtggggtgatcagcccaaaaatcatgatttggagtgatctgatcagtgctgataggcagtttacaaagggattctggcttgtgacttcagtgaggacaatcccccagggccctttctttccatgcctctccaactcagagccaatgtctttgggtgggctagatagatagggcatacaattggcctggttcctccaagctcttaattcactttatcaatagttccatttaaattgacttcaatgataagagtgtatcccatttgagattgcttgcgttgtgggggagggggaggaggaacacattaagataattcacatgggcaaagggaggtcttggagtgtagccgttaagccatcttgtaaccccattcatgattttgaccacctgctagagagaagaggtgccaagagactagaacttggaggcttggctgtcccactaataggctttcgcaaggcagaggtagccagctaggtccctgccttcccagccaggtacagctctcaggtttgtggaggtaatctgtgaacttctcttcctgctgccttcttgtgatgtccagagcccacagtcaaatacctcctaagaaccctggcttccttccctctaatccactggcacatgactatcacctctggattgacctcagatccatagcctacacactgctagcagtggccaagatcacttcctttatctccatctgttctgttctccaggaaagtaagtggggatgagggtggaggtggtaatcaactgtagatctgtggctttatgagccttcagacttctctctggcttcttctggaagggttactattggcagtattgcaatctcaccctcctgatgaactgtagcctgtgccgttactgtgctgggcatgatctccagtgcttgcaagtcccatgatttctttggtgattttgagggtggggggagggacacaaatcagcttagcttagcttcctgtctgtgaatgtccatatagtgtattgtgttttaacaaatgatctacactgactgttgctgtaaaagtgaatttggaaataaagttattactctgaataaa 5338 RNA PAT source 1..5338 mol_type mRNA organism Mus musculus tttattcagagtaataactttatttccaaattcacttttacagcaacagtcagtgtagatcatttgttaaaacacaatacactatatggacattcacagacaggaagctaagctaagctgatttgtgtccctccccccaccctcaaaatcaccaaagaaatcatgggacttgcaagcactggagatcatgcccagcacagtaacggcacaggctacagttcatcaggagggtgagattgcaatactgccaatagtaacccttccagaagaagccagagagaagtctgaaggctcataaagccacagatctacagttgattaccacctccaccctcatccccacttactttcctggagaacagaacagatggagataaaggaagtgatcttggccactgctagcagtgtgtaggctatggatctgaggtcaatccagaggtgatagtcatgtgccagtggattagagggaaggaagccagggttcttaggaggtatttgactgtgggctctggacatcacaagaaggcagcaggaagagaagttcacagattacctccacaaacctgagagctgtacctggctgggaaggcagggacctagctggctacctctgccttgcgaaagcctattagtgggacagccaagcctccaagttctagtctcttggcacctcttctctctagcaggtggtcaaaatcatgaatggggttacaagatggcttaacggctacactccaagacctccctttgcccatgtgaattatcttaatgtgttcctcctccccctcccccacaacgcaagcaatctcaaatgggatacactcttatcattgaagtcaatttaaatggaactattgataaagtgaattaagagcttggaggaaccaggccaattgtatgccctatctatctagcccacccaaagacattggctctgagttggagaggcatggaaagaaagggccctgggggattgtcctcactgaagtcacaagccagaatccctttgtaaactgcctatcagcactgatcagatcactccaaatcatgatttttgggctgatcaccccacaagagataggcagagcaccccaccccccattcaaggacaggaactgcgggatgggtaaatgggtgtaagagagagaaccacgacaggtaaccatgatgaagaaaccacacttttcctccctcggactcacttctatggacagctaaagtcttatcagtggggaagctcacaataggtagccctgggcactcaagagttctttaatgggaaaggctggctgcttcctcctagtctccacattgtccttaactgtacatcagaagtggctgatgtgggcctgaggttcctaatcttcaaaggcctagtccctgaagctgtaggaggtcgtgcaagttcagggggctgacagcttggaaaccaagggagtctcctaagatgtccccttcatcagtgggacagtccatcccaaactctatggtgaaaaggcccaggcttggagagggcccaaggatatctactgggtcgtcatggaatttctagggtcacagctctccctgctggtactggtgtccttttctcttgtgatgcaggagttcttagatgtctttcagggctactgtgggatttgaagtcgtgatcagaaaggaccatcttcatacaaaacaggccagccacaagctctccctggcactcggagcctgctgcctctagctggtcctgtgcttcaggccttggccaatgccattgacctccaatgtcacagacctccaatgtcacaatccagtgtctgtgaggtcccagatgcagaagaaacccttcaaaacatgggatgtcccagcaggttagcactgcactggcctggagccacgtcaggaaggagatatccagactctccatcacgtggtgggctagaaccttttgacaaatatttcaagatacatgcgtccttttttttttcctttttctttttctttttttttttttttttctttttctttcttttcttttcactatcatagtcactctggtgaacccagacaaacagacaaatccaactacaacgtaacagggcgaagacgggaaagaaagggctgcatctatggaggtggccgtctgctccagcagggcaggcagcatggtttccatgggaccggaggaaaaaaacacttcaatcaagggggtatgttccccaaactggggtgtggagactgattacgtgcatggggacttaatggcagctgagctctgggaggctagcgatcacaagctggggtggaagcgaaagatgggagaagtgtggccctgccctgggactcttgactgttcttactgatgccaagacattggcacctgacttggctgcctccagctcaacacaaggagtcaggcctaggaggcatccacttagataaaagaaaaggcagaggtccaaggtcatccccaggcaggcacacaccagttcccatccaggataggaagtaatggagtgaaccaaacaaggtcgtaaggttccttgtgggaggcacactggttggattcgtggaacgtaggactagagactgaggcccaaatctttgccttccctggactccaacccctagtgtagagcagatattgcccatatctacccaggggccagggatgggggctgggagaggcatggcactcaggacagtgagacgtgatgtacggacggcagtgactagctctcgtggcagacgtgggcatgataggacagagagaggggatacagtggctgtgtgagggatgggaggcctgggacccacatcccagaataccaccccccatccctcccactacagaagtgccagagggccaagcatgagaacaggcagaggtcccccaagaggcacaagtccttacaaagatctggttagccctaaagtcccaggtctgtaatggtggccaaatcatggctgtagttccaaacttgagaactcagtaaagcagcttttcctgtgggagcgaagggaaacacctcgctcaggacctcccaccttgcggggagggaggaagaagccagtgccctgggatgtcaagagcagccttcaagagaaccaatctacaaggtaccacctgctggcttaccttccttctgcccaataccccttctcccacaggctgccctgcagaaggggcacacacacccacgttacccccacagtgctttatcaagcaggcatctgagctagctaggactgctgcaggcagctgcagcaccctgtcctccccaagctacttggcaaggagccagtgtcccctctcccaacctgccttcctcacctctgtcctctaactcagtccacccatccatctctcagccttcgctgtcgctgtttcagtccccactcacacccacacaagttaacagcacctgcctacggccccacgaacacaccaagtctcaaatctctcattgctgccactgtccctgaagcccctaggatggggctatgggcaattagctgccctagtccctcagccactccccagaagcagcctccagagccttcttcaccctctaatactcagagagggagggcggggtcaggggggggaaatcaattagcaattgcccaaggaaattttttggccatgtttttacatgtttttttttcccttaaatatgttttatttttagcccacaaatcaatttggaaagatgaaatgtacttttcccatcactgattttgaagtcccgagccaaatccgagccacaaaagcaggttaggtgacaagcaggtcagcctgtctatgaggagcagcggggagggcagagggcaaggggccagatcattctttttttttttttttttccacactctcactctctcttctctccatgattattgactgccctgggagcctgatcacaaaccctgcttggccaaggaagcagacacttcatcggctagtgtggcaagctgtggtgagtccaccatgtcgatgctgcccgtggaagacacattgctgaggtgccgtggagatgtgtccccagacaccacgggtgacttatacacaatttctgctccatggtctgtcttggctttggcattctccctgaaggtcagcttgtgggtttcaatcttcttattccctcctccagggacgtgggtgatattatccaaggagccaatcttcgactggactctgtccttgaagtccagcttctctgattttacttccacctggccacctcctggcttgtgatggatgttccctaacgagccacacttggaggtcactttgctcaggtccaccggcttgtagactatttgcacactgcctccacccgggacgtgtttgatattatccttcgagccacacttggactggacgttgctaagatccagcttcttattaattatctgcaccttgccacctcctggctggtgcttcaggttctcagtagagccaatcttcgacctgacattctttaggtctggcatgggcacaggggcagtctgcaggcggctcttactagctgatggtgacttagggggagtgcggaccactgccaccttcttgggctcccgggtgggcggtgttggtagggatggggtgcgcgagcgactgccaggcgttccgggagagccggggctgctgtagccgcttcgttctccggattttggtggttcacctgaccctggaggagtcttagggctgggcgtggtcttggccgggatcctggtggcgttggacgtgcccttctgggccggagaggctgctccccgaggtgtggcgatcttcgccccggttttgccatcagcgcccttggctttcttctcgtcatttcctgtcctgtctttgctggccacacgagcttgagtcacatgcccagcggcttggtcctcctggttcggggtgtctccgatgcctgcttcttcggctgtaattccttctgggatctccgtgtggggctgggcagcggcctgcttgtcgggagctctctcatccactaggggcgcagtcacgtcttcagcagttggagtgctcttagcatcggaggtctccgaccctggttcctccgctccatcatcggcggggggctgtgggggagactcttttaagccatggtccatgtctccttcttggtcttggagcagagtgtaatctccagcatggtcttccattgtgtcaaactcctggcgagggtcagccatactggttcaaagcctgataatcgacagaaggcgaggacagaagaggacagcggaggagaaggtggttgtggcggcggcggcagaaggtgggcggtggcggcggcgctgctgctggtgctggagctggtgggtggcggagact 5632 RNA PAT source 1..5632 mol_type mRNA organism Macaca mulatta ctcgggaacgcgccctcttcgccggcgcgcgccctcgcagtcaccgccacccaccagctccggcaccaacagcagcgccgctgccaccgcccaccttctgccgccgccaccacagccaccttctcctcctccgctgtcctctcccgtcctcgcctctgtcgactatcaggcgagccttgaaccaggatggctgagccccgccaggagttcgatgtgatggaagatcacgctgggacgtacgggttgggggacaggaaagatcaagagggctacaccatgctccaagaccaagagggtgacacggacgctggcctgaaagaatctcccctgcagacccccgctgaggatggatctgaggaactgggctctgaaacctctgatgctaagagcactccaacggcggaagatgtgacagcgcccttagtggatgagagagctcccggcgagcaggctgccgcccagccccacatggagatcccagaaggaaccacagctgaggaagcaggcatcggagacacccccagcctggaagacgaagctgctggtcacgtgacccaagctcgcatggtcagtaaaagcaaagacgggactggaagcgatgacaaaaaagccaagggggctgatgggaaaacgaagatcgccacaccccggggagcggcccctccaggccagaagggccaagccaacgccaccaggattccagcaaaaaccccgcccgccccaaagacaccacccagctctggtgaacctccaaaatcaggggatcgcagtggctacagcagccccggctccccgggcactcccggcagccgctcccgcaccccgtcccttccaacccctccagcccgggagcccaagaaggtggcggtggtccgtactccacctaagtcgccgtcttccgccaagagccgcctgcagacagcccccgtgcccatgccagacctgaagaacgtcaagtccaagatcggctccaccgagaacctgaagcaccagccgggaggcgggaaggtgcagataattaataagaagctggatcttagcaacgtccagtccaagtgtggctcaaaggataatatcaaacacgtcccgggaggcggcagtgtgcaaatagtctacaaaccagttgacctgagcaaggtgacctccaagtgtggctcattaggcaacatccatcataaaccaggaggtggccaggtggaagtaaaatctgagaagctggacttcaaggacagagtgcagtcgaagatcgggtccctggacaatatcacccatgtccctggcggaggaaataaaaagattgaaacccacaagctgaccttccgcgagaacgccaaagccaagacagaccacggggcggaaatcgtgtacaagtcgccggtggtgtctggggacacgtctccacggcacctcagcaatgtctcctccaccggcagcatcgacatggtagactcgccccagctcgccacgctagccgacgaggtgtctgcctccctggccaagcagggtttgtgatcaggcccccggggcggtcaataatcgtggagagaagagagagtgagagtgtggaaaaaaaaagaataatgacccggccccgccctctgcccccagctgctcctcgcagttcggttaatcggttcatcacttaaccggcttttatcgctcggctttggctcgggacttcaaaatcagtgatgggaataagagcaaattgcatctttccaaattgatcggtgggctaataataaaatattttttaaaaaacattcaaaaacatggccacacccaacatttcctcgggcaattccttttgattctttttttttccccctccatgtagaagagggagaaggagaggctgtgaaagctgcttcggggggatttcaagagactgggggtgcccaccgcctctggccctgtcgtgggggtgtcacagaggcagcggcagcaacaaaggatttgaaacttggtgtgttcgtggagccacaggcagacgatgtcaaccttgtgtgagtgtgacgggtgcgggtggggcgggaggccatgggggaggccaaggcaggggctgggcagaggggagaggaagccacatgctggagaggagatgccctcctccgcgccactgggagggccaaggcctccgccacctgcagtgtctcagactgagcggctgcctgtccttggtggccagggtctgctgcgagttgatgtgccaccctctgcagggcagcctgtgggagaaggggcggcgggtaagaagagaaggcaagctggcgggagggtggcaccccatggatgacctccttggaaaagactgaccttgatgtcggagggcgctggcctcttcctccctccctgcagggtagggggcctgagcagaggggcttccctctgctccacagaaaccctgttttattgagttctgaaggttggaactgcagccatgattttggccactttgcagacctgggactttagggctaaccagttctctttgtaaggacttgtgcctcttgggagacgtccacccgtttccaagcctgggccaccggcatctctgaagtgtgcaggggtctgggaggcgggtcccgagccccctgtccttcccacggccactgcagtcacccctgtctgccccactgtgctgtcgtctgccatgagaacccagtcactgcctatacccctcatcacgtcacaacgtccaaattcccagcctcaccaccccccttctcagtaaggaccctggttggctgtgggaggcacctactccatactgagggtgaaattaagggaaggtaaagtccaggcacaagagtgggaccccagcctctcactctcagttccactcatccaactgggtccctcaccacgaatctcacgacctgattcggttccctgcctcctcctcccatcacagatgtgagccagggcactgctcagctgtgaccctcggtgtttctgccttgttgacatagagagagccctttccccccgagaaggcctggcctcttcccgtgctgagcccgcagcaggaggctgggtgtcctggttgtcggtgacggcaccaggatgggcgggcaaggcacccagggcaggcccacagtcccgctgtcccccacttgcaccccagcttgtggctgccagcctcccagacagcccagcccgctgctcagctccacatgtgtagaatcagccctccacatcccaaaaaggggaacacacccccttcgaaatggttttctccccggtcccagctggaagccatgctgtctgttctgctggagcagctgaacatatacatagatgttgccctgccctccccatctgcaccctgttgcgttgtagttggatttgtctgtttatgcttggattcaccagagtgactatgatagtgaaaagaaaaaaaaaaaaaaaaaaaggacgcatgtatcttgaaatgcttgtaaagaggtttctaacccaccctcacaaggtgtctctcacccccacgctgggacgcgtgtggcctgtgtggcgccgccctgctggggcctcccaaggtttgaaaggctttcctcagcatccgggacccaacagagaccagattctagcatctaaggaggccgttcagctgtgaagaaggcctgaagcacaggattaggactgaagcgatgccatctccttccctacttccccttggggctccctgtgtcagggcagagagtaggtcttgtggctggtctggcttgcggcacgaggatggttctctctggtcacagcccgaagtcccacagcagtcctaaaggaggcttacaactcctgcatcacaagaagaaggaagccagtgccagctggggggatctgcagctcccagaagctccatgagcctcagccaccccgcagactgggttcctcgccaagctcgccctctggaggggcagccagcctcccaccaagggccctgcgaccacagcagggattgggatgaattgcctatcctggatctgctccagaggcccgagccacctgcctgaggaaggataagtcaggagacaccgttcccaaagccttgaccagagcacctcagcccactgaccttgcacaaactccatctgctgccatgagaaaagggaagccgcctttgcaaaaaattgctgcctaaagaaactcagcagcctcaggctcaattctgccgcttctggtttgggtacagttaaaggcaaccctgagggacttggcagtagaaatccagggcatcccctagggctggcaacttcgtgtgcagctagagctttccctgcaagaagtttctgggcccagaactctccaccaggaagctccctgctgttcgctaagtcccagcaattctctaagtgaagggatctgagaatgaggaggaaatgtggggtagagatttggtggtggttagagacatgcccccctcattactgccaacagtttcggctgcatttttcacgtacctcggttcctcttcctgaagttcttgtgccctgctcttcagcaccgtgggccttatccggtaggctctgggatctcccccttgtggggcaggctcttggggccagcctaagatcatggtttagggtgatcagtgctggcagataaattgcaaaggcacgctggcttgtgacctcaaatgacaatccccccagggctgggcactcctcccctcccctcacttctcccacctgcagagccagtgtccgtgggtgggctagataggatatactgtatgccggctccttcaagctgttgactcactttatcaatagttccatttaaattgacttcaatggtgagactgtatcctgtttgctattgcttattgtgctatggggggaggggggaggaatgtgtaacatagttaacatgggtaaagggagatcttggggtgcagcacttcaattgcctcgtaacccttttcatcatttcaaccacatttgctaaagggagggagcagccacgcggttagaggcccttggggtttctcttttccactgacagcctttcccaggcagctggccagttccccattccctccccagccaggtgcaggcgtagcaatatggacatctggttgctttggcctgctgccctctttcaggggtcctaagcccacaatcatgcctccctaagaccctggcatccttccttttaagccgttggcacctctgtgccacctctcacactggctccagacacagcctgtgcttctggcagctgagatcactcacttccccctcctcatctttgttggagctccaagtcaagccacgaggtcagggcgagggcagaggtggtcaccagcgtgtcccatctacagacctgtggcttcgtaagacttctgatttctcttcagctttgaaaagggttaccctgggcactggcctagagtctcacctcctaatagacttacccccatgagtttgccatgttgagcaggacaatttctggcacttgcaagtcccatgatttcttcggtaattgtgagggtggggggagggacatgaaatcatcttagcttagcttcctgtctgtgaatgtctatatagtgtattgtgtgttttaacaaatgatttacactgactgttgccgtaaaagtgaatttggaaataaagttattactctgattaaa 5632 RNA PAT source 1..5632 mol_type mRNA organism Macaca mulatta tttaatcagagtaataactttatttccaaattcacttttacggcaacagtcagtgtaaatcatttgttaaaacacacaatacactatatagacattcacagacaggaagctaagctaagatgatttcatgtccctccccccaccctcacaattaccgaagaaatcatgggacttgcaagtgccagaaattgtcctgctcaacatggcaaactcatgggggtaagtctattaggaggtgagactctaggccagtgcccagggtaacccttttcaaagctgaagagaaatcagaagtcttacgaagccacaggtctgtagatgggacacgctggtgaccacctctgccctcgccctgacctcgtggcttgacttggagctccaacaaagatgaggagggggaagtgagtgatctcagctgccagaagcacaggctgtgtctggagccagtgtgagaggtggcacagaggtgccaacggcttaaaaggaaggatgccagggtcttagggaggcatgattgtgggcttaggacccctgaaagagggcagcaggccaaagcaaccagatgtccatattgctacgcctgcacctggctggggagggaatggggaactggccagctgcctgggaaaggctgtcagtggaaaagagaaaccccaagggcctctaaccgcgtggctgctccctccctttagcaaatgtggttgaaatgatgaaaagggttacgaggcaattgaagtgctgcaccccaagatctccctttacccatgttaactatgttacacattcctcccccctccccccatagcacaataagcaatagcaaacaggatacagtctcaccattgaagtcaatttaaatggaactattgataaagtgagtcaacagcttgaaggagccggcatacagtatatcctatctagcccacccacggacactggctctgcaggtgggagaagtgaggggaggggaggagtgcccagccctggggggattgtcatttgaggtcacaagccagcgtgcctttgcaatttatctgccagcactgatcaccctaaaccatgatcttaggctggccccaagagcctgccccacaagggggagatcccagagcctaccggataaggcccacggtgctgaagagcagggcacaagaacttcaggaagaggaaccgaggtacgtgaaaaatgcagccgaaactgttggcagtaatgaggggggcatgtctctaaccaccaccaaatctctaccccacatttcctcctcattctcagatcccttcacttagagaattgctgggacttagcgaacagcagggagcttcctggtggagagttctgggcccagaaacttcttgcagggaaagctctagctgcacacgaagttgccagccctaggggatgccctggatttctactgccaagtccctcagggttgcctttaactgtacccaaaccagaagcggcagaattgagcctgaggctgctgagtttctttaggcagcaattttttgcaaaggcggcttcccttttctcatggcagcagatggagtttgtgcaaggtcagtgggctgaggtgctctggtcaaggctttgggaacggtgtctcctgacttatccttcctcaggcaggtggctcgggcctctggagcagatccaggataggcaattcatcccaatccctgctgtggtcgcagggcccttggtgggaggctggctgcccctccagagggcgagcttggcgaggaacccagtctgcggggtggctgaggctcatggagcttctgggagctgcagatccccccagctggcactggcttccttcttcttgtgatgcaggagttgtaagcctcctttaggactgctgtgggacttcgggctgtgaccagagagaaccatcctcgtgccgcaagccagaccagccacaagacctactctctgccctgacacagggagccccaaggggaagtagggaaggagatggcatcgcttcagtcctaatcctgtgcttcaggccttcttcacagctgaacggcctccttagatgctagaatctggtctctgttgggtcccggatgctgaggaaagcctttcaaaccttgggaggccccagcagggcggcgccacacaggccacacgcgtcccagcgtgggggtgagagacaccttgtgagggtgggttagaaacctctttacaagcatttcaagatacatgcgtcctttttttttttttttttttcttttcactatcatagtcactctggtgaatccaagcataaacagacaaatccaactacaacgcaacagggtgcagatggggagggcagggcaacatctatgtatatgttcagctgctccagcagaacagacagcatggcttccagctgggaccggggagaaaaccatttcgaagggggtgtgttcccctttttgggatgtggagggctgattctacacatgtggagctgagcagcgggctgggctgtctgggaggctggcagccacaagctggggtgcaagtgggggacagcgggactgtgggcctgccctgggtgccttgcccgcccatcctggtgccgtcaccgacaaccaggacacccagcctcctgctgcgggctcagcacgggaagaggccaggccttctcggggggaaagggctctctctatgtcaacaaggcagaaacaccgagggtcacagctgagcagtgccctggctcacatctgtgatgggaggaggaggcagggaaccgaatcaggtcgtgagattcgtggtgagggacccagttggatgagtggaactgagagtgagaggctggggtcccactcttgtgcctggactttaccttcccttaatttcaccctcagtatggagtaggtgcctcccacagccaaccagggtccttactgagaaggggggtggtgaggctgggaatttggacgttgtgacgtgatgaggggtataggcagtgactgggttctcatggcagacgacagcacagtggggcagacaggggtgactgcagtggccgtgggaaggacagggggctcgggacccgcctcccagacccctgcacacttcagagatgccggtggcccaggcttggaaacgggtggacgtctcccaagaggcacaagtccttacaaagagaactggttagccctaaagtcccaggtctgcaaagtggccaaaatcatggctgcagttccaaccttcagaactcaataaaacagggtttctgtggagcagagggaagcccctctgctcaggccccctaccctgcagggagggaggaagaggccagcgccctccgacatcaaggtcagtcttttccaaggaggtcatccatggggtgccaccctcccgccagcttgccttctcttcttacccgccgccccttctcccacaggctgccctgcagagggtggcacatcaactcgcagcagaccctggccaccaaggacaggcagccgctcagtctgagacactgcaggtggcggaggccttggccctcccagtggcgcggaggagggcatctcctctccagcatgtggcttcctctcccctctgcccagcccctgccttggcctcccccatggcctcccgccccacccgcacccgtcacactcacacaaggttgacatcgtctgcctgtggctccacgaacacaccaagtttcaaatcctttgttgctgccgctgcctctgtgacacccccacgacagggccagaggcggtgggcacccccagtctcttgaaatccccccgaagcagctttcacagcctctccttctccctcttctacatggagggggaaaaaaaaagaatcaaaaggaattgcccgaggaaatgttgggtgtggccatgtttttgaatgttttttaaaaaatattttattattagcccaccgatcaatttggaaagatgcaatttgctcttattcccatcactgattttgaagtcccgagccaaagccgagcgataaaagccggttaagtgatgaaccgattaaccgaactgcgaggagcagctgggggcagagggcggggccgggtcattattctttttttttccacactctcactctctcttctctccacgattattgaccgccccgggggcctgatcacaaaccctgcttggccagggaggcagacacctcgtcggctagcgtggcgagctggggcgagtctaccatgtcgatgctgccggtggaggagacattgctgaggtgccgtggagacgtgtccccagacaccaccggcgacttgtacacgatttccgccccgtggtctgtcttggctttggcgttctcgcggaaggtcagcttgtgggtttcaatctttttatttcctccgccagggacatgggtgatattgtccagggacccgatcttcgactgcactctgtccttgaagtccagcttctcagattttacttccacctggccacctcctggtttatgatggatgttgcctaatgagccacacttggaggtcaccttgctcaggtcaactggtttgtagactatttgcacactgccgcctcccgggacgtgtttgatattatcctttgagccacacttggactggacgttgctaagatccagcttcttattaattatctgcaccttcccgcctcccggctggtgcttcaggttctcggtggagccgatcttggacttgacgttcttcaggtctggcatgggcacgggggctgtctgcaggcggctcttggcggaagacggcgacttaggtggagtacggaccaccgccaccttcttgggctcccgggctggaggggttggaagggacggggtgcgggagcggctgccgggagtgcccggggagccggggctgctgtagccactgcgatcccctgattttggaggttcaccagagctgggtggtgtctttggggcgggcggggtttttgctggaatcctggtggcgttggcttggcccttctggcctggaggggccgctccccggggtgtggcgatcttcgttttcccatcagcccccttggcttttttgtcatcgcttccagtcccgtctttgcttttactgaccatgcgagcttgggtcacgtgaccagcagcttcgtcttccaggctgggggtgtctccgatgcctgcttcctcagctgtggttccttctgggatctccatgtggggctgggcggcagcctgctcgccgggagctctctcatccactaagggcgctgtcacatcttccgccgttggagtgctcttagcatcagaggtttcagagcccagttcctcagatccatcctcagcgggggtctgcaggggagattctttcaggccagcgtccgtgtcaccctcttggtcttggagcatggtgtagccctcttgatctttcctgtcccccaacccgtacgtcccagcgtgatcttccatcacatcgaactcctggcggggctcagccatcctggttcaaggctcgcctgatagtcgacagaggcgaggacgggagaggacagcggaggaggagaaggtggctgtggtggcggcggcagaaggtgggcggtggcagcggcgctgctgttggtgccggagctggtgggtggcggtgactgcgagggcgcgcgccggcgaagagggcgcgttcccgag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcctcctccgctgtcctctca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggagttcgaagtgatggaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgagttcgaagtgatggaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagttcgaagtgatggaagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttcgaagtgatggaagata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttcgaagtgatggaagatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcgaagtgatggaagatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggctacaccatgcaccaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cacacggacgctggcctgaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacccccagcctggaagacga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caagctgctggtcacgtgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaagctcgcatggtcagtaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaagctcgcatggtcagtaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggctcgcatggtcagtaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcgcatggtcagtaaaagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgcatggtcagtaaaagcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcatggtcagtaaaagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccatggtcagtaaaagcaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatggtcagtaaaagcaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggtcagtaaaagcaaagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggtcagtaaaagcaaagaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgactggaagcgatgacaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cactggaagcgatgacaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggaagcgatgacaaaaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaagcgatgacaaaaaagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcgatgacaaaaaagccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcgatgacaaaaaagccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcaagggggctgatggtaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgggctgatggtaaaacgaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggctgatggtaaaacgaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctgatggtaaaacgaagata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgatggtaaaacgaagatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggatggtaaaacgaagatcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggccaccaggattccagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaggattccagcaaaaacca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccacccagctctggtgaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctggtgaacctccaaaatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggtgaacctccaaaatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacctccaaaatcaggggata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcggctccactgagaaccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtgtgcaaatagtctacaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgtgcaaatagtctacaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtgcaaatagtctacaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgcaaatagtctacaaacca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcaaatagtctacaaaccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatagtctacaaaccagtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatagtctacaaaccagttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtagtctacaaaccagttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtacaaaccagttgacctgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaaggtgacctccaagtgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggacctccaagtgtggctcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcctccaagtgtggctcatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtccaagtgtggctcattaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgtggctcattaggcaacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctggctcattaggcaacatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgctcattaggcaacatccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctcattaggcaacatccata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcattaggcaacatccatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttaggcaacatccatcataa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaggcaacatccatcataaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggcaacatccatcataaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaacatccatcataaaccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacatccatcataaaccagga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaggtggaagtaaaatctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaggtggaagtaaaatctgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggtggaagtaaaatctgaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgtggaagtaaaatctgagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctggaagtaaaatctgagaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggaagtaaaatctgagaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caagtaaaatctgagaagcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagtaaaatctgagaagctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctaaaatctgagaagcttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgagaagcttgacttcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgagaagcttgacttcaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggaagcttgacttcaaggaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caagcttgacttcaaggacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaggacagagtccagtcgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcagagtccagtcgaagatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggcggaggaaataaaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgcggaggaaataaaaagata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaataaaaagattgaaaccca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaagattgaaacccacaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggagatcgtgtacaagtcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccatctcagcaatgtctccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccggcagcatcgacatgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcatcgacatggtagacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cccacgctagctgacgaggta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cccaagcagggtttgtgatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaagcagggtttgtgatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgagagagtgtggaaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaaaagaataatgaccca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcctcgcagttcggttaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaattggttaatcacttaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gattggttaatcacttaacca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggttaatcacttaacctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatcacttaacctgctttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatcacttaacctgcttttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcacttaacctgcttttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcacttaacctgcttttgtca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgctcgggacttcaaaatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcgggacttcaaaatcagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgacttcaaaatcagtgatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cacttcaaaatcagtgatgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaagagcaaatttcatcttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagagcaaatttcatctttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggagcaaatttcatctttcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagcaaatttcatctttccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcaaatttcatctttccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaaatttcatctttccaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaatttcatctttccaaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatttcatctttccaaatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatttcatctttccaaattga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttcatctttccaaattgata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggtgggctagtaataaaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggggctagtaataaaatatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaggcaattccttttgatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggcaattccttttgattcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgcagcaacaaaggatttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcaacaaaggatttgaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcaacaaaggatttgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaacaaaggatttgaaacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaacaaaggatttgaaactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacaaaggatttgaaacttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaaaggatttgaaacttgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaggatttgaaacttggta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaggatttgaaacttggtgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggatttgaaacttggtgtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct catttgaaacttggtgtgtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttgaaacttggtgtgttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggccatgattttggccactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttggccactttgcagaccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttgcagacctgggacttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cacctgggactttagggctaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cactttagggctaaccagtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggctaaccagttctctttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgctaaccagttctctttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaaccagttctctttgtaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaccagttctctttgtaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccagttctctttgtaagga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccagttctctttgtaaggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcagttctctttgtaaggaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttctctttgtaaggactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtctctttgtaaggacttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatcactgcctataccccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtactccatactgagggtgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcatactgagggtgaaattaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatactgagggtgaaattaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtactgagggtgaaattaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gactgagggtgaaattaagga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagggtgaaattaagggaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaccccagcctctcactcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcctctcactctcagttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccctctcactctcagttccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcactctcagttccactcata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gactctcagttccactcatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcagttccactcatccaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaggtgtttctgccttgtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgtttctgccttgttgacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtttctgccttgttgacata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctggaagccatgctgtctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaagccatgctgtctgttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagccatgctgtctgttctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cccatgctgtctgttctgcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctggagcagctgaacatata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggagcagctgaacatataa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagcagctgaacatatacata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccagctgaacatatacataga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagctgaacatatacatagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggctgaacatatacatagata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctgaacatatacatagatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgaacatatacatagatgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggaacatatacatagatgtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caacatatacatagatgttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacatatacatagatgttgca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggagttgtagttggatttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagttgtagttggatttgtca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttgtagttggatttgtcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttgtagttggatttgtctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgtagttggatttgtctgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtagttggatttgtctgtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctagttggatttgtctgttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagttggatttgtctgtttaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttggatttgtctgtttata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttggatttgtctgtttatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggatttgtctgtttatgca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggatttgtctgtttatgcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgatttgtctgtttatgctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct catttgtctgtttatgcttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttgtctgtttatgcttgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttgtctgtttatgcttggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgtctgtttatgcttggata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtctgtttatgcttggatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctctgtttatgcttggattca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgtttatgcttggattcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgtttatgcttggattcaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtatgcttggattcaccagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggattcaccagagtgactaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgattcaccagagtgactata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cattcaccagagtgactatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaaaaaaggacgcatgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaaaaaggacgcatgtaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaaaaggacgcatgtata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaaaggacgcatgtatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaggacgcatgtatctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaggacgcatgtatcttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaggacgcatgtatcttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaggacgcatgtatcttgaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgacgcatgtatcttgaaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaactcctgcatcacaagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cactcactttatcaatagtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctcactttatcaatagttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcactttatcaatagttcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcactttatcaatagttccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctttatcaatagttccatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttatcaatagttccatttaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtatcaatagttccatttaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatagttccatttaaattga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatagttccatttaaattgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtagttccatttaaattgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttccatttaaattgacttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacttgcaagtcccatgatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttgcaagtcccatgatttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgcaagtcccatgatttcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcaagtcccatgatttctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggaaatcatcttagcttagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatcatcttagcttagctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtctatatagtgtattgtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatgatttacactgactgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgatttacactgactgttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttacactgactgttgctgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtacactgactgttgctgtaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacactgactgttgctgtaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcactgactgttgctgtaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgactgttgctgtaaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgactgttgctgtaaaagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggactgttgctgtaaaagtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cactgttgctgtaaaagtgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgttgctgtaaaagtgaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgttgctgtaaaagtgaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctgtaaaagtgaatttggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgtaaaagtgaatttggaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtgaatttggaaataaagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggaaataaagttattactca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaaataaagttattactcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gataaagttattactctgata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaagttattactctgattaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcctccgctgtcctctca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagttcgaagtgatggaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttcgaagtgatggaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttcgaagtgatggaagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcgaagtgatggaagata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgaagtgatggaagatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgaagtgatggaagatcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctacaccatgcaccaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacggacgctggcctgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccccagcctggaagacga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agctgctggtcacgtgaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagctcgcatggtcagtaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agctcgcatggtcagtaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcgcatggtcagtaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgcatggtcagtaaaagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcatggtcagtaaaagcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catggtcagtaaaagcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggtcagtaaaagcaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggtcagtaaaagcaaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtcagtaaaagcaaagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcagtaaaagcaaagaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actggaagcgatgacaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggaagcgatgacaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagcgatgacaaaaaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagcgatgacaaaaaagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcgatgacaaaaaagccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgatgacaaaaaagccaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caagggggctgatggtaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggctgatggtaaaacgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgatggtaaaacgaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatggtaaaacgaagata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatggtaaaacgaagatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggtaaaacgaagatcga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaccaggattccagcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggattccagcaaaaacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccacccagctctggtgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggtgaacctccaaaatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtgaacctccaaaatcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctccaaaatcaggggata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cggctccactgagaaccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgcaaatagtctacaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgcaaatagtctacaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcaaatagtctacaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaaatagtctacaaacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaatagtctacaaaccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atagtctacaaaccagtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagtctacaaaccagttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtctacaaaccagttgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaaaccagttgacctgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggtgacctccaagtgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acctccaagtgtggctcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctccaagtgtggctcatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaagtgtggctcattaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtggctcattaggcaacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggctcattaggcaacatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcattaggcaacatccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcattaggcaacatccata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attaggcaacatccatcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taggcaacatccatcataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggcaacatccatcataaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaacatccatcataaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacatccatcataaaccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catccatcataaaccagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggtggaagtaaaatctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtggaagtaaaatctgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtggaagtaaaatctgaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggaagtaaaatctgagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaagtaaaatctgagaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagtaaaatctgagaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtaaaatctgagaagcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaaaatctgagaagctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaatctgagaagcttgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgagaagcttgacttcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagaagcttgacttcaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagcttgacttcaaggaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcttgacttcaaggacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggacagagtccagtcgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agagtccagtcgaagatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcggaggaaataaaaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cggaggaaataaaaagata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataaaaagattgaaaccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagattgaaacccacaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagatcgtgtacaagtcga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctcagcaatgtctccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccggcagcatcgacatgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcatcgacatggtagacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacgctagctgacgaggta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caagcagggtttgtgatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagcagggtttgtgatcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagagagtgtggaaaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaaagaataatgaccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctcgcagttcggttaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attggttaatcacttaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggttaatcacttaacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggttaatcacttaacctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcacttaacctgctttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcacttaacctgcttttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacttaacctgcttttgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttaacctgcttttgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcgggacttcaaaatcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgggacttcaaaatcagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttcaaaatcagtgatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttcaaaatcagtgatgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agagcaaatttcatcttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagcaaatttcatctttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcaaatttcatctttcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaaatttcatctttccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaatttcatctttccaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatttcatctttccaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatttcatctttccaaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttcatctttccaaatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcatctttccaaattga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatctttccaaattgata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgggctagtaataaaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggctagtaataaaatatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggcaattccttttgatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaattccttttgattcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagcaacaaaggatttgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaacaaaggatttgaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caacaaaggatttgaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacaaaggatttgaaacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaaaggatttgaaactta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaaggatttgaaacttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaggatttgaaacttgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggatttgaaacttggta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggatttgaaacttggtgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatttgaaacttggtgtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgaaacttggtgtgtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaaacttggtgtgttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccatgattttggccactta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggccactttgcagaccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgcagacctgggacttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctgggactttagggctaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttagggctaaccagtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctaaccagttctctttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctaaccagttctctttgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaccagttctctttgtaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accagttctctttgtaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagttctctttgtaagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagttctctttgtaaggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttctctttgtaaggaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctctttgtaaggactta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctctttgtaaggacttgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcactgcctataccccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actccatactgagggtgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atactgagggtgaaattaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactgagggtgaaattaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgagggtgaaattaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgagggtgaaattaagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggtgaaattaagggaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accccagcctctcactcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcctctcactctcagttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctctcactctcagttccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actctcagttccactcata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctctcagttccactcatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagttccactcatccaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggtgtttctgccttgtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttctgccttgttgacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttctgccttgttgacata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggaagccatgctgtctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagccatgctgtctgttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccatgctgtctgttctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catgctgtctgttctgcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggagcagctgaacatata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagcagctgaacatataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcagctgaacatatacata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agctgaacatatacataga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgaacatatacatagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgaacatatacatagata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaacatatacatagatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaacatatacatagatgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacatatacatagatgtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acatatacatagatgttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catatacatagatgttgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttgtagttggatttgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttgtagttggatttgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtagttggatttgtcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtagttggatttgtctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtagttggatttgtctgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagttggatttgtctgtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttggatttgtctgttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttggatttgtctgtttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggatttgtctgtttata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggatttgtctgtttatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggatttgtctgtttatgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatttgtctgtttatgcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttgtctgtttatgctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgtctgtttatgcttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtctgtttatgcttgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtctgtttatgcttggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctgtttatgcttggata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgtttatgcttggatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtttatgcttggattca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttatgcttggattcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttatgcttggattcaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgcttggattcaccagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gattcaccagagtgactaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attcaccagagtgactata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaccagagtgactatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaaaaaggacgcatgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaaaaggacgcatgtaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaaaggacgcatgtata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaaggacgcatgtatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaggacgcatgtatctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggacgcatgtatcttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggacgcatgtatcttgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggacgcatgtatcttgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acgcatgtatcttgaaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aactcctgcatcacaagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcactttatcaatagtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcactttatcaatagttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cactttatcaatagttcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actttatcaatagttccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttatcaatagttccatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcaatagttccatttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcaatagttccatttaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atagttccatttaaattga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagttccatttaaattgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttccatttaaattgaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccatttaaattgacttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgcaagtcccatgatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcaagtcccatgatttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaagtcccatgatttcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caagtcccatgatttctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatcatcttagcttagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcatcttagcttagctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctatatagtgtattgtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgatttacactgactgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatttacactgactgttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacactgactgttgctgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acactgactgttgctgtaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cactgactgttgctgtaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgactgttgctgtaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgactgttgctgtaaaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gactgttgctgtaaaagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgttgctgtaaaagtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgttgctgtaaaagtgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttgctgtaaaagtgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttgctgtaaaagtgaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtaaaagtgaatttggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaaaagtgaatttggaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaatttggaaataaagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaataaagttattactca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaataaagttattactcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaagttattactctgata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttattactctgattaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgagaggacagcggaggaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttccatcacttcgaactccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttccatcacttcgaactcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcttccatcacttcgaactg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcttccatcacttcgaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatcttccatcacttcgaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgatcttccatcacttcgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttggtgcatggtgtagccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttcaggccagcgtccgtgtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgtcttccaggctgggggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtcacgtgaccagcagcttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttactgaccatgcgagctttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttactgaccatgcgagcttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttactgaccatgcgagcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcttttactgaccatgcgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgcttttactgaccatgcgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgcttttactgaccatgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttgcttttactgaccatgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctttgcttttactgaccatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttctttgcttttactgaccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtctttgcttttactgaccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttgtcatcgcttccagtcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttgtcatcgcttccagtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttttttgtcatcgcttccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcttttttgtcatcgcttcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggcttttttgtcatcgctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggcttttttgtcatcgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttaccatcagcccccttgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttcgttttaccatcagcccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttcgttttaccatcagccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcttcgttttaccatcagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatcttcgttttaccatcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgatcttcgttttaccatcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctggaatcctggtggcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggtttttgctggaatcctgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttcaccagagctgggtggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgattttggaggttcaccagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgattttggaggttcaccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcccctgattttggaggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggttctcagtggagccgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgtagactatttgcacacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttgtagactatttgcacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttgtagactatttgcacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggtttgtagactatttgcag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggtttgtagactatttgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taactggtttgtagactattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaactggtttgtagactatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaactggtttgtagactac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaggtcaactggtttgtac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacacttggaggtcaccttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgagccacacttggaggtcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatgagccacacttggaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctaatgagccacacttggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgttgcctaatgagccacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatgttgcctaatgagccag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggatgttgcctaatgagcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatggatgttgcctaatgagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgatggatgttgcctaatgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttatgatggatgttgcctaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttatgatggatgttgcctac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttatgatggatgttgccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggtttatgatggatgttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcctggtttatgatggatgtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagattttacttccacctgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcagattttacttccacctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctcagattttacttccaccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttctcagattttacttccacg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttctcagattttacttccag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttctcagattttacttccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagcttctcagattttacttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagcttctcagattttactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaagcttctcagattttag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgaagtcaagcttctcagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttgaagtcaagcttctcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtccttgaagtcaagcttcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtccttgaagtcaagcttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcgactggactctgtccttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatcttcgactggactctgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctttttatttcctccgccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatctttttatttcctccgcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgggtttcaatctttttattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgtgggtttcaatcttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgacttgtacacgatctccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggagacattgctgagatgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccatgtcgatgctgccggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagtctaccatgtcgatgctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacctcgtcagctagcgtggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatcacaaaccctgcttggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgatcacaaaccctgcttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttttccacactctctcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgggtcattattctttttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattaaccgaactgcgaggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttaagtgattaaccaattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggttaagtgattaaccaatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaggttaagtgattaaccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaaagcaggttaagtgattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaaagcaggttaagtgatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaaaagcaggttaagtgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgacaaaagcaggttaagtgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgattttgaagtcccgagcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactgattttgaagtcccgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcatcactgattttgaagtcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccatcactgattttgaagtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaagatgaaatttgctcttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaaagatgaaatttgctctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggaaagatgaaatttgctcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggaaagatgaaatttgctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggaaagatgaaatttgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttggaaagatgaaatttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatttggaaagatgaaatttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatttggaaagatgaaattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaatttggaaagatgaaatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcaatttggaaagatgaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattttattactagcccaccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatattttattactagcccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatcaaaaggaattgcctgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagaatcaaaaggaattgccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaaatcctttgttgctgcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttcaaatcctttgttgctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcaaatcctttgttgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagtttcaaatcctttgttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtttcaaatcctttgttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaagtttcaaatcctttgtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccaagtttcaaatcctttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taccaagtttcaaatcctttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaccaagtttcaaatcctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacaccaagtttcaaatccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taacacaccaagtttcaaatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaacacaccaagtttcaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtggccaaaatcatggcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggtctgcaaagtggccaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaagtcccaggtctgcaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttagccctaaagtcccaggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taactggttagccctaaagtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaagagaactggttagccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaaagagaactggttagcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttacaaagagaactggttac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttacaaagagaactggttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccttacaaagagaactggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttccttacaaagagaactggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtccttacaaagagaactgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtccttacaaagagaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaagtccttacaaagagac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggggtataggcagtgattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaccctcagtatggagtac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttaatttcaccctcagtatgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttaatttcaccctcagtatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttaatttcaccctcagtac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccttaatttcaccctcagtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttcccttaatttcaccctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagagtgagaggctggggtcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaactgagagtgagaggctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggaactgagagtgagaggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgagtggaactgagagtgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatgagtggaactgagagtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttggatgagtggaactgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taacaaggcagaaacacctac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtcaacaaggcagaaacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgtcaacaaggcagaaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagacagcatggcttccagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaacagacagcatggcttcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagaacagacagcatggctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagcagaacagacagcatggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatatgttcagctgctccagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttatatgttcagctgctccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgtatatgttcagctgctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctatgtatatgttcagctgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttctatgtatatgttcagctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatctatgtatatgttcagcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcatctatgtatatgttcagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacatctatgtatatgttcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taacatctatgtatatgttcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaacatctatgtatatgttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcaacatctatgtatatgtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaaatccaactacaactcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgacaaatccaactacaactg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagacaaatccaactacaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagacaaatccaactacaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacagacaaatccaactacac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taacagacaaatccaactacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaacagacaaatccaactag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttaaacagacaaatccaactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tataaacagacaaatccaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcataaacagacaaatccaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcataaacagacaaatccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagcataaacagacaaatccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagcataaacagacaaatcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaagcataaacagacaaatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccaagcataaacagacaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttccaagcataaacagacaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatccaagcataaacagacac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatccaagcataaacagacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaatccaagcataaacagag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgaatccaagcataaacagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtgaatccaagcataaacac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttctggtgaatccaagcatac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttagtcactctggtgaatccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatagtcactctggtgaatcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcatagtcactctggtgaatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacatgcgtcctttttttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttacatgcgtccttttttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatacatgcgtcctttttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatacatgcgtccttttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagatacatgcgtccttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaagatacatgcgtcctttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaagatacatgcgtccttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttcaagatacatgcgtcctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatttcaagatacatgcgtcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcttgtgatgcaggagttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taactattgataaagtgagtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaactattgataaagtgagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggaactattgataaagtgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggaactattgataaagtgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatggaactattgataaagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttaaatggaactattgataac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttaaatggaactattgatac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaatttaaatggaactattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaatttaaatggaactatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtcaatttaaatggaactac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaagtcaatttaaatggaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatcatgggacttgcaagtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaaatcatgggacttgcaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagaaatcatgggacttgcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagaaatcatgggacttgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgctaagctaagatgatttcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagctaagctaagatgattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacaatacactatatagacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacagtcagtgtaaatcattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaacagtcagtgtaaatcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacagcaacagtcagtgtaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttacagcaacagtcagtgtac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttacagcaacagtcagtgtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttacagcaacagtcagtgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttttacagcaacagtcagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacttttacagcaacagtcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacttttacagcaacagtcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcacttttacagcaacagtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttcacttttacagcaacagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattcacttttacagcaacac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttccaaattcacttttacagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttccaaattcacttttacac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactttatttccaaattcacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgagtaataactttatttccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagagtaataactttatttcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcagagtaataactttatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttaatcagagtaataacttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgagaggacagcggaggag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttccatcacttcgaactc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttccatcacttcgaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcttccatcacttcgaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcttccatcacttcgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatcttccatcacttcga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgatcttccatcacttcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttggtgcatggtgtagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcaggccagcgtccgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgtcttccaggctggggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtcacgtgaccagcagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttactgaccatgcgagctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttactgaccatgcgagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttttactgaccatgcgag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcttttactgaccatgcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgcttttactgaccatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgcttttactgaccatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttgcttttactgaccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctttgcttttactgacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctttgcttttactgacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtctttgcttttactgac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttgtcatcgcttccagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttttgtcatcgcttccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttttttgtcatcgcttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcttttttgtcatcgctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggcttttttgtcatcgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttggcttttttgtcatcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttaccatcagcccccttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcgttttaccatcagcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttcgttttaccatcagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcttcgttttaccatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatcttcgttttaccatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgatcttcgttttaccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgctggaatcctggtgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggtttttgctggaatcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcaccagagctgggtgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgattttggaggttcacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgattttggaggttcacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcccctgattttggagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taggttctcagtggagccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgtagactatttgcaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttgtagactatttgcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttgtagactatttgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggtttgtagactatttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggtttgtagactatttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taactggtttgtagactat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaactggtttgtagacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaactggtttgtagact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaggtcaactggtttgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacacttggaggtcacctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgagccacacttggaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatgagccacacttggag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctaatgagccacacttgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgttgcctaatgagccac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgttgcctaatgagcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggatgttgcctaatgag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatggatgttgcctaatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgatggatgttgcctaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatgatggatgttgccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttatgatggatgttgcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttatgatggatgttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggtttatgatggatgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctggtttatgatggatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagattttacttccacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcagattttacttccacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctcagattttacttccac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctcagattttacttcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttctcagattttacttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttctcagattttacttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagcttctcagattttact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagcttctcagattttac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaagcttctcagatttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgaagtcaagcttctca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttgaagtcaagcttctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtccttgaagtcaagctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtccttgaagtcaagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcgactggactctgtcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatcttcgactggactct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctttttatttcctccgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatctttttatttcctccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggtttcaatctttttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgtgggtttcaatcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgacttgtacacgatctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taggagacattgctgagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccatgtcgatgctgccgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagtctaccatgtcgatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacctcgtcagctagcgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatcacaaaccctgcttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgatcacaaaccctgctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttttttccacactctctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggtcattattctttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tattaaccgaactgcgagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttaagtgattaaccaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggttaagtgattaaccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaggttaagtgattaacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaaagcaggttaagtgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaaagcaggttaagtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacaaaagcaggttaagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacaaaagcaggttaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgattttgaagtcccgag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactgattttgaagtcccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatcactgattttgaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccatcactgattttgaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaagatgaaatttgctct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaaagatgaaatttgctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggaaagatgaaatttgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggaaagatgaaatttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttggaaagatgaaatttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttggaaagatgaaattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatttggaaagatgaaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatttggaaagatgaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaatttggaaagatgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcaatttggaaagatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tattttattactagcccac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatattttattactagcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatcaaaaggaattgcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagaatcaaaaggaattgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaaatcctttgttgctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttcaaatcctttgttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttcaaatcctttgttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagtttcaaatcctttgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagtttcaaatcctttgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaagtttcaaatcctttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccaagtttcaaatccttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taccaagtttcaaatcctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacaccaagtttcaaatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcacaccaagtttcaaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taacacaccaagtttcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaacacaccaagtttcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagtggccaaaatcatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taggtctgcaaagtggcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaagtcccaggtctgcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttagccctaaagtcccagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taactggttagccctaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaagagaactggttagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacaaagagaactggttag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttacaaagagaactggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttacaaagagaactggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccttacaaagagaactgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttccttacaaagagaactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtccttacaaagagaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagtccttacaaagagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacaagtccttacaaagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taggggtataggcagtgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaccctcagtatggagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaatttcaccctcagtat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttaatttcaccctcagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttaatttcaccctcagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccttaatttcaccctcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttcccttaatttcaccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagagtgagaggctggggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaactgagagtgagaggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggaactgagagtgagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgagtggaactgagagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgagtggaactgagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttggatgagtggaactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taacaaggcagaaacacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtcaacaaggcagaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgtcaacaaggcagaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagacagcatggcttcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaacagacagcatggctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagaacagacagcatggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagcagaacagacagcatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatatgttcagctgctcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatatgttcagctgctcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgtatatgttcagctgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctatgtatatgttcagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctatgtatatgttcagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatctatgtatatgttcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatctatgtatatgttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacatctatgtatatgttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taacatctatgtatatgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaacatctatgtatatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcaacatctatgtatatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacaaatccaactacaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacaaatccaactacaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagacaaatccaactacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagacaaatccaactaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacagacaaatccaactac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taacagacaaatccaacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaacagacaaatccaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaaacagacaaatccaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tataaacagacaaatccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcataaacagacaaatcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcataaacagacaaatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagcataaacagacaaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagcataaacagacaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaagcataaacagacaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccaagcataaacagacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttccaagcataaacagaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatccaagcataaacagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatccaagcataaacaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaatccaagcataaacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaatccaagcataaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgaatccaagcataaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctggtgaatccaagcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttagtcactctggtgaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatagtcactctggtgaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatagtcactctggtgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacatgcgtcctttttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttacatgcgtccttttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatacatgcgtcctttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatacatgcgtccttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagatacatgcgtccttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaagatacatgcgtcctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaagatacatgcgtcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcaagatacatgcgtcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatttcaagatacatgcgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcttgtgatgcaggagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taactattgataaagtgag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaactattgataaagtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggaactattgataaagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggaactattgataaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatggaactattgataaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaaatggaactattgata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttaaatggaactattgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaatttaaatggaactat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaatttaaatggaacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtcaatttaaatggaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaagtcaatttaaatgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatcatgggacttgcaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaaatcatgggacttgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagaaatcatgggacttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagaaatcatgggacttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgctaagctaagatgattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagctaagctaagatgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcacaatacactatataga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacagtcagtgtaaatcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaacagtcagtgtaaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacagcaacagtcagtgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttacagcaacagtcagtgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttacagcaacagtcagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttacagcaacagtcagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttttacagcaacagtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacttttacagcaacagtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcacttttacagcaacagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcacttttacagcaacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcacttttacagcaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tattcacttttacagcaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttccaaattcacttttaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttccaaattcacttttac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactttatttccaaattca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgagtaataactttatttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagagtaataactttattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcagagtaataacttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttaatcagagtaataact 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcctcctccgctgtcctctca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggagttcgaagtgatggaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgagttcgaagtgatggaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagttcgaagtgatggaagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttcgaagtgatggaagata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttcgaagtgatggaagatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcgaagtgatggaagatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggctacaccatgcaccaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cacacggacgctggcctgaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacccccagcctggaagacga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caagctgctggtcacgtgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaagctcgcatggtcagtaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaagctcgcatggtcagtaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggctcgcatggtcagtaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcgcatggtcagtaaaagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgcatggtcagtaaaagcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcatggtcagtaaaagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccatggtcagtaaaagcaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatggtcagtaaaagcaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggtcagtaaaagcaaagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggtcagtaaaagcaaagaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgactggaagcgatgacaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cactggaagcgatgacaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggaagcgatgacaaaaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaagcgatgacaaaaaagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcgatgacaaaaaagccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcgatgacaaaaaagccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcaagggggctgatggtaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgggctgatggtaaaacgaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggctgatggtaaaacgaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctgatggtaaaacgaagata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgatggtaaaacgaagatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggatggtaaaacgaagatcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggccaccaggattccagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaggattccagcaaaaacca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccacccagctctggtgaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctggtgaacctccaaaatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggtgaacctccaaaatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacctccaaaatcaggggata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcggctccactgagaaccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtgtgcaaatagtctacaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgtgcaaatagtctacaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtgcaaatagtctacaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgcaaatagtctacaaacca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcaaatagtctacaaaccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatagtctacaaaccagtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatagtctacaaaccagttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtagtctacaaaccagttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtacaaaccagttgacctgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaaggtgacctccaagtgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggacctccaagtgtggctcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcctccaagtgtggctcatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtccaagtgtggctcattaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgtggctcattaggcaacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctggctcattaggcaacatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgctcattaggcaacatccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctcattaggcaacatccata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcattaggcaacatccatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttaggcaacatccatcataa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaggcaacatccatcataaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggcaacatccatcataaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaacatccatcataaaccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacatccatcataaaccagga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaggtggaagtaaaatctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaggtggaagtaaaatctgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggtggaagtaaaatctgaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgtggaagtaaaatctgagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctggaagtaaaatctgagaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggaagtaaaatctgagaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caagtaaaatctgagaagcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagtaaaatctgagaagctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctaaaatctgagaagcttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgagaagcttgacttcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgagaagcttgacttcaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggaagcttgacttcaaggaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caagcttgacttcaaggacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaggacagagtccagtcgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcagagtccagtcgaagatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggcggaggaaataaaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgcggaggaaataaaaagata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaataaaaagattgaaaccca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaagattgaaacccacaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggagatcgtgtacaagtcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccatctcagcaatgtctccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccggcagcatcgacatgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcatcgacatggtagacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cccacgctagctgacgaggta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cccaagcagggtttgtgatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaagcagggtttgtgatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgagagagtgtggaaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaaaagaataatgaccca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcctcgcagttcggttaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaattggttaatcacttaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gattggttaatcacttaacca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggttaatcacttaacctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatcacttaacctgctttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatcacttaacctgcttttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcacttaacctgcttttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcacttaacctgcttttgtca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgctcgggacttcaaaatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcgggacttcaaaatcagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgacttcaaaatcagtgatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cacttcaaaatcagtgatgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaagagcaaatttcatcttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagagcaaatttcatctttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggagcaaatttcatctttcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagcaaatttcatctttccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcaaatttcatctttccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaaatttcatctttccaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaatttcatctttccaaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatttcatctttccaaatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatttcatctttccaaattga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttcatctttccaaattgata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggtgggctagtaataaaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggggctagtaataaaatatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaggcaattccttttgatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggcaattccttttgattcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgcagcaacaaaggatttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcaacaaaggatttgaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcaacaaaggatttgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaacaaaggatttgaaacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaacaaaggatttgaaactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacaaaggatttgaaacttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaaaggatttgaaacttgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaggatttgaaacttggta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaggatttgaaacttggtgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggatttgaaacttggtgtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct catttgaaacttggtgtgtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttgaaacttggtgtgttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggccatgattttggccactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttggccactttgcagaccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttgcagacctgggacttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cacctgggactttagggctaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cactttagggctaaccagtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggctaaccagttctctttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgctaaccagttctctttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaaccagttctctttgtaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaccagttctctttgtaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccagttctctttgtaagga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccagttctctttgtaaggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcagttctctttgtaaggaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttctctttgtaaggactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtctctttgtaaggacttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatcactgcctataccccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtactccatactgagggtgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcatactgagggtgaaattaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatactgagggtgaaattaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtactgagggtgaaattaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gactgagggtgaaattaagga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagggtgaaattaagggaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaccccagcctctcactcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcctctcactctcagttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccctctcactctcagttccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcactctcagttccactcata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gactctcagttccactcatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcagttccactcatccaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaggtgtttctgccttgtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgtttctgccttgttgacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtttctgccttgttgacata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctggaagccatgctgtctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaagccatgctgtctgttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagccatgctgtctgttctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cccatgctgtctgttctgcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctggagcagctgaacatata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggagcagctgaacatataa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagcagctgaacatatacata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccagctgaacatatacataga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagctgaacatatacatagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggctgaacatatacatagata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctgaacatatacatagatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgaacatatacatagatgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggaacatatacatagatgtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caacatatacatagatgttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacatatacatagatgttgca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggagttgtagttggatttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagttgtagttggatttgtca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttgtagttggatttgtcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttgtagttggatttgtctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgtagttggatttgtctgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtagttggatttgtctgtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctagttggatttgtctgttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagttggatttgtctgtttaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttggatttgtctgtttata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttggatttgtctgtttatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggatttgtctgtttatgca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggatttgtctgtttatgcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgatttgtctgtttatgctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct catttgtctgtttatgcttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttgtctgtttatgcttgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttgtctgtttatgcttggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgtctgtttatgcttggata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtctgtttatgcttggatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctctgtttatgcttggattca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgtttatgcttggattcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgtttatgcttggattcaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtatgcttggattcaccagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggattcaccagagtgactaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgattcaccagagtgactata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cattcaccagagtgactatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaaaaaaggacgcatgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaaaaaggacgcatgtaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaaaaggacgcatgtata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaaaggacgcatgtatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaggacgcatgtatctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaggacgcatgtatcttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaggacgcatgtatcttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaggacgcatgtatcttgaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgacgcatgtatcttgaaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaactcctgcatcacaagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cactcactttatcaatagtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctcactttatcaatagttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcactttatcaatagttcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcactttatcaatagttccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctttatcaatagttccatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttatcaatagttccatttaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtatcaatagttccatttaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatagttccatttaaattga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatagttccatttaaattgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtagttccatttaaattgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttccatttaaattgacttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacttgcaagtcccatgatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttgcaagtcccatgatttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgcaagtcccatgatttcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcaagtcccatgatttctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggaaatcatcttagcttagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatcatcttagcttagctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtctatatagtgtattgtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatgatttacactgactgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgatttacactgactgttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttacactgactgttgctgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtacactgactgttgctgtaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacactgactgttgctgtaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcactgactgttgctgtaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgactgttgctgtaaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgactgttgctgtaaaagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggactgttgctgtaaaagtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cactgttgctgtaaaagtgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgttgctgtaaaagtgaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgttgctgtaaaagtgaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctgtaaaagtgaatttggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgtaaaagtgaatttggaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtgaatttggaaataaagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggaaataaagttattactca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaaataaagttattactcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gataaagttattactctgata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaagttattactctgattaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgagaggacagcggaggaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttccatcacttcgaactccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttccatcacttcgaactcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcttccatcacttcgaactg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcttccatcacttcgaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatcttccatcacttcgaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgatcttccatcacttcgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttggtgcatggtgtagccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttcaggccagcgtccgtgtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgtcttccaggctgggggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtcacgtgaccagcagcttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttactgaccatgcgagctttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttactgaccatgcgagcttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttactgaccatgcgagcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcttttactgaccatgcgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgcttttactgaccatgcgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgcttttactgaccatgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttgcttttactgaccatgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctttgcttttactgaccatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttctttgcttttactgaccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtctttgcttttactgaccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttgtcatcgcttccagtcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttgtcatcgcttccagtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttttttgtcatcgcttccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcttttttgtcatcgcttcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggcttttttgtcatcgctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggcttttttgtcatcgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttaccatcagcccccttgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttcgttttaccatcagcccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttcgttttaccatcagccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcttcgttttaccatcagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatcttcgttttaccatcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgatcttcgttttaccatcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctggaatcctggtggcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggtttttgctggaatcctgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttcaccagagctgggtggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgattttggaggttcaccagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgattttggaggttcaccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcccctgattttggaggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggttctcagtggagccgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgtagactatttgcacacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttgtagactatttgcacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttgtagactatttgcacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggtttgtagactatttgcag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggtttgtagactatttgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taactggtttgtagactattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaactggtttgtagactatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaactggtttgtagactac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaggtcaactggtttgtac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacacttggaggtcaccttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgagccacacttggaggtcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatgagccacacttggaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctaatgagccacacttggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgttgcctaatgagccacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatgttgcctaatgagccag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggatgttgcctaatgagcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatggatgttgcctaatgagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgatggatgttgcctaatgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttatgatggatgttgcctaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttatgatggatgttgcctac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttatgatggatgttgccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggtttatgatggatgttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcctggtttatgatggatgtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagattttacttccacctgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcagattttacttccacctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctcagattttacttccaccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttctcagattttacttccacg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttctcagattttacttccag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttctcagattttacttccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagcttctcagattttacttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagcttctcagattttactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaagcttctcagattttag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgaagtcaagcttctcagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttgaagtcaagcttctcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtccttgaagtcaagcttcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtccttgaagtcaagcttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcgactggactctgtccttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatcttcgactggactctgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctttttatttcctccgccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatctttttatttcctccgcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgggtttcaatctttttattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgtgggtttcaatcttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgacttgtacacgatctccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggagacattgctgagatgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccatgtcgatgctgccggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagtctaccatgtcgatgctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacctcgtcagctagcgtggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatcacaaaccctgcttggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgatcacaaaccctgcttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttttccacactctctcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgggtcattattctttttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattaaccgaactgcgaggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttaagtgattaaccaattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggttaagtgattaaccaatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaggttaagtgattaaccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaaagcaggttaagtgattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaaagcaggttaagtgatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaaaagcaggttaagtgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgacaaaagcaggttaagtgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgattttgaagtcccgagcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactgattttgaagtcccgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcatcactgattttgaagtcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccatcactgattttgaagtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaagatgaaatttgctcttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaaagatgaaatttgctctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggaaagatgaaatttgctcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggaaagatgaaatttgctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggaaagatgaaatttgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttggaaagatgaaatttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatttggaaagatgaaatttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatttggaaagatgaaattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaatttggaaagatgaaatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcaatttggaaagatgaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattttattactagcccaccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatattttattactagcccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatcaaaaggaattgcctgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagaatcaaaaggaattgccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaaatcctttgttgctgcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttcaaatcctttgttgctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcaaatcctttgttgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagtttcaaatcctttgttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtttcaaatcctttgttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaagtttcaaatcctttgtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccaagtttcaaatcctttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taccaagtttcaaatcctttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaccaagtttcaaatcctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacaccaagtttcaaatccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taacacaccaagtttcaaatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaacacaccaagtttcaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtggccaaaatcatggcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggtctgcaaagtggccaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaagtcccaggtctgcaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttagccctaaagtcccaggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taactggttagccctaaagtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaagagaactggttagccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaaagagaactggttagcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttacaaagagaactggttac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttacaaagagaactggttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccttacaaagagaactggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttccttacaaagagaactggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtccttacaaagagaactgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtccttacaaagagaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaagtccttacaaagagac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggggtataggcagtgattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaccctcagtatggagtac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttaatttcaccctcagtatgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttaatttcaccctcagtatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttaatttcaccctcagtac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccttaatttcaccctcagtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttcccttaatttcaccctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagagtgagaggctggggtcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaactgagagtgagaggctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggaactgagagtgagaggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgagtggaactgagagtgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatgagtggaactgagagtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttggatgagtggaactgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taacaaggcagaaacacctac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtcaacaaggcagaaacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgtcaacaaggcagaaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagacagcatggcttccagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaacagacagcatggcttcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagaacagacagcatggctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagcagaacagacagcatggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatatgttcagctgctccagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttatatgttcagctgctccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgtatatgttcagctgctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctatgtatatgttcagctgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttctatgtatatgttcagctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatctatgtatatgttcagcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcatctatgtatatgttcagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacatctatgtatatgttcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taacatctatgtatatgttcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaacatctatgtatatgttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcaacatctatgtatatgtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaaatccaactacaactcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgacaaatccaactacaactg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagacaaatccaactacaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagacaaatccaactacaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacagacaaatccaactacac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taacagacaaatccaactacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaacagacaaatccaactag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttaaacagacaaatccaactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tataaacagacaaatccaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcataaacagacaaatccaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcataaacagacaaatccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagcataaacagacaaatccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagcataaacagacaaatcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaagcataaacagacaaatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccaagcataaacagacaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttccaagcataaacagacaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatccaagcataaacagacac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatccaagcataaacagacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaatccaagcataaacagag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgaatccaagcataaacagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtgaatccaagcataaacac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttctggtgaatccaagcatac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttagtcactctggtgaatccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatagtcactctggtgaatcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcatagtcactctggtgaatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacatgcgtcctttttttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttacatgcgtccttttttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatacatgcgtcctttttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatacatgcgtccttttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagatacatgcgtccttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaagatacatgcgtcctttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaagatacatgcgtccttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttcaagatacatgcgtcctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatttcaagatacatgcgtcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcttgtgatgcaggagttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taactattgataaagtgagtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaactattgataaagtgagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggaactattgataaagtgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggaactattgataaagtgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatggaactattgataaagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttaaatggaactattgataac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttaaatggaactattgatac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaatttaaatggaactattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaatttaaatggaactatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtcaatttaaatggaactac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaagtcaatttaaatggaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatcatgggacttgcaagtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaaatcatgggacttgcaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagaaatcatgggacttgcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagaaatcatgggacttgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgctaagctaagatgatttcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagctaagctaagatgattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacaatacactatatagacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacagtcagtgtaaatcattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaacagtcagtgtaaatcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacagcaacagtcagtgtaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttacagcaacagtcagtgtac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttacagcaacagtcagtgtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttacagcaacagtcagtgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttttacagcaacagtcagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacttttacagcaacagtcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacttttacagcaacagtcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcacttttacagcaacagtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttcacttttacagcaacagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattcacttttacagcaacac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttccaaattcacttttacagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttccaaattcacttttacac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactttatttccaaattcacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgagtaataactttatttccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagagtaataactttatttcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcagagtaataactttatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttaatcagagtaataacttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttcgaagtgatggaagatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cacacggacgctggcctgaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcgatgacaaaaaagccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgggctgatggtaaaacgaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctggtgaacctccaaaatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggtgaacctccaaaatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacctccaaaatcaggggata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttaggcaacatccatcataa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaggtggaagtaaaatctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caagtaaaatctgagaagcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgagaagcttgacttcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcagagtccagtcgaagatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgcggaggaaataaaaagata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcacttaacctgcttttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgacttcaaaatcagtgatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagagcaaatttcatctttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgctaaccagttctctttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggagttgtagttggatttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgtttatgcttggattcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacactgactgttgctgtaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatggtcagtaaaagcaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cactggaagcgatgacaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaagcgatgacaaaaaagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtgcaaatagtctacaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttaggcaacatccatcataa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctggaagtaaaatctgagaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caagtaaaatctgagaagcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagtaaaatctgagaagctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctaaaatctgagaagcttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggaagcttgacttcaaggaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaggacagagtccagtcgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgagagagtgtggaaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaaaagaataatgaccca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggttaatcacttaacctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatcacttaacctgcttttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcacttaacctgcttttgtca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgctcgggacttcaaaatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaagagcaaatttcatcttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagagcaaatttcatctttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggagcaaatttcatctttcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagcaaatttcatctttccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcaaatttcatctttccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaaatttcatctttccaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaatttcatctttccaaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatttcatctttccaaatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatttcatctttccaaattga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttcatctttccaaattgata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggtgggctagtaataaaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggggctagtaataaaatatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcaacaaaggatttgaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct catttgaaacttggtgtgtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggctaaccagttctctttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcaaatagtctacaaaccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggaaataaagttattactca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcaaatagtctacaaaccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggaaataaagttattactca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatcttccatcacttcgaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttcaggccagcgtccgtgtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggcttttttgtcatcgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttcgttttaccatcagcccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgattttggaggttcaccagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgattttggaggttcaccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcccctgattttggaggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttatgatggatgttgcctaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagattttacttccacctgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagcttctcagattttacttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgaagtcaagcttctcagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatcttcgactggactctgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatctttttatttcctccgcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaaaagcaggttaagtgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcatcactgattttgaagtcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaaagatgaaatttgctctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaaagagaactggttagcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaaatccaactacaactcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgaatccaagcataaacagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttacagcaacagtcagtgtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctttgcttttactgaccatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttgtcatcgcttccagtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcttttttgtcatcgcttcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttgtagactatttgcacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttatgatggatgttgcctaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttctcagattttacttccag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagcttctcagattttacttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagcttctcagattttactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaagcttctcagattttag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtccttgaagtcaagcttcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcgactggactctgtccttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttttccacactctctcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgggtcattattctttttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaggttaagtgattaaccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaaagcaggttaagtgatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgacaaaagcaggttaagtgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgattttgaagtcccgagcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaagatgaaatttgctcttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaaagatgaaatttgctctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggaaagatgaaatttgctcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggaaagatgaaatttgctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggaaagatgaaatttgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttggaaagatgaaatttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatttggaaagatgaaatttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatttggaaagatgaaattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaatttggaaagatgaaatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcaatttggaaagatgaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattttattactagcccaccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatattttattactagcccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttcaaatcctttgttgctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taacacaccaagtttcaaatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaagagaactggttagccg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttggtttgtagactatttgcaca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgagtaataactttatttccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggtttgtagactatttgca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgagtaataactttatttcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcatggtcagtaaaagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggtcagtaaaagcaaagaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgactggaagcgatgacaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggaagcgatgacaaaaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcgatgacaaaaaagccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcgatgacaaaaaagccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcggctccactgagaaccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtgtgcaaatagtctacaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgtgcaaatagtctacaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgcaaatagtctacaaacca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcaaatagtctacaaaccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatagtctacaaaccagtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatagtctacaaaccagttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtagtctacaaaccagttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtacaaaccagttgacctgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgtggctcattaggcaacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctggctcattaggcaacatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctcattaggcaacatccata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaggcaacatccatcataaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacatccatcataaaccagga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaggtggaagtaaaatctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaggtggaagtaaaatctgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggtggaagtaaaatctgaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgtggaagtaaaatctgagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggaagtaaaatctgagaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgagaagcttgacttcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caagcttgacttcaaggacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcagagtccagtcgaagatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggcaattccttttgattcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaacaaaggatttgaaacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaacaaaggatttgaaactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaaccagttctctttgtaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccagttctctttgtaagga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccagttctctttgtaaggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttctctttgtaaggactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatactgagggtgaaattaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagggtgaaattaagggaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcactctcagttccactcata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaggtgtttctgccttgtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtttctgccttgttgacata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccagctgaacatatacataga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgtagttggatttgtctgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtagttggatttgtctgtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctagttggatttgtctgttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggatttgtctgtttatgca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgatttgtctgtttatgctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttgtctgtttatgcttgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgtctgtttatgcttggata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggaagtaaaatctgagaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggaagtaaaatctgagaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgcatggtcagtaaaagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaagctcgcatggtcagtaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggctcgcatggtcagtaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcgcatggtcagtaaaagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgcatggtcagtaaaagcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccatggtcagtaaaagcaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggtcagtaaaagcaaagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaaggtgacctccaagtgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggacctccaagtgtggctcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcctccaagtgtggctcatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtccaagtgtggctcattaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgctcattaggcaacatccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcattaggcaacatccatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggcaacatccatcataaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaacatccatcataaaccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgagaagcttgacttcaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcctcgcagttcggttaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaattggttaatcacttaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gattggttaatcacttaacca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatcacttaacctgctttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcgggacttcaaaatcagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cacttcaaaatcagtgatgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cactggaagcgatgacaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggaagcgatgacaaaaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaagcgatgacaaaaaagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcgatgacaaaaaagccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcgatgacaaaaaagccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgggctgatggtaaaacgaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtgcaaatagtctacaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcaaatagtctacaaaccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtagtctacaaaccagttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttaggcaacatccatcataa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaggtggaagtaaaatctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtaaaatctgagaagcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttcatctttccaaattgata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggcaattccttttgattcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaacaaaggatttgaaacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaacaaaggatttgaaactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cactggaagcgatgacaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggaagcgatgacaaaaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaagcgatgacaaaaaagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcgatgacaaaaaagccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcgatgacaaaaaagccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgggctgatggtaaaacgaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtgcaaatagtctacaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcaaatagtctacaaaccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtagtctacaaaccagttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttaggcaacatccatcataa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaggtggaagtaaaatctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtaaaatctgagaagcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttcatctttccaaattgata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggcaattccttttgattcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaacaaaggatttgaaacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaacaaaggatttgaaactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cactggaagcgatgacaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggaagcgatgacaaaaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaagcgatgacaaaaaagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcgatgacaaaaaagccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcgatgacaaaaaagccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgggctgatggtaaaacgaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtgcaaatagtctacaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcaaatagtctacaaaccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtagtctacaaaccagttgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttaggcaacatccatcataa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaggtggaagtaaaatctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtaaaatctgagaagcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttcatctttccaaattgata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggcaattccttttgattcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaacaaaggatttgaaacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaacaaaggatttgaaactta 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct caggtggaagtaaaatctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgcttttactgaccatgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtctttgcttttactgaccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttgtcatcgcttccagtcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttttttgtcatcgcttccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggcttttttgtcatcgctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggcttttttgtcatcgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggttctcagtggagccgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgtagactatttgcacacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttgtagactatttgcacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggtttgtagactatttgcag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggtttgtagactatttgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taactggtttgtagactattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaactggtttgtagactatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaactggtttgtagactac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaggtcaactggtttgtac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgttgcctaatgagccacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatgttgcctaatgagccag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatggatgttgcctaatgagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttatgatggatgttgcctac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcctggtttatgatggatgtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagattttacttccacctgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcagattttacttccacctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctcagattttacttccaccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttctcagattttacttccacg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttctcagattttacttccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgaagtcaagcttctcagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtccttgaagtcaagcttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatcttcgactggactctgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagaatcaaaaggaattgccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagtttcaaatcctttgttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtttcaaatcctttgttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttacaaagagaactggttac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccttacaaagagaactggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttccttacaaagagaactggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtccttacaaagagaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttaatttcaccctcagtatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttcccttaatttcaccctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgagtggaactgagagtgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taacaaggcagaaacacctac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgtcaacaaggcagaaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctatgtatatgttcagctgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacagacaaatccaactacac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taacagacaaatccaactacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaacagacaaatccaactag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcataaacagacaaatccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagcataaacagacaaatcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccaagcataaacagacaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatccaagcataaacagacac 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tttctcagattttacttccacct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tttctcagattttacttccacct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tttgcttttactgaccatgcgag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttactgaccatgcgagcttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttactgaccatgcgagcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcttttactgaccatgcgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgcttttactgaccatgcgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttgcttttactgaccatgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttctttgcttttactgaccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacacttggaggtcaccttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgagccacacttggaggtcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatgagccacacttggaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctaatgagccacacttggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggatgttgcctaatgagcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgatggatgttgcctaatgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttatgatggatgttgccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggtttatgatggatgttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttgaagtcaagcttctcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattaaccgaactgcgaggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttaagtgattaaccaattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggttaagtgattaaccaatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaaagcaggttaagtgattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactgattttgaagtcccgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccatcactgattttgaagtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttgtcatcgcttccagtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttttttgtcatcgcttccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcttttttgtcatcgcttcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggcttttttgtcatcgctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggcttttttgtcatcgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttcgttttaccatcagcccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttgtagactatttgcacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggtttgtagactatttgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaactggtttgtagactac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttatgatggatgttgcctaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagattttacttccacctgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagcttctcagattttactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcaatttggaaagatgaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagaatcaaaaggaattgccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagtttcaaatcctttgttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtttcaaatcctttgttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttgtcatcgcttccagtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttttttgtcatcgcttccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcttttttgtcatcgcttcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggcttttttgtcatcgctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggcttttttgtcatcgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttcgttttaccatcagcccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttgtagactatttgcacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggtttgtagactatttgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaactggtttgtagactac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttatgatggatgttgcctaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagattttacttccacctgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagcttctcagattttactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcaatttggaaagatgaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagaatcaaaaggaattgccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagtttcaaatcctttgttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtttcaaatcctttgttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttgtcatcgcttccagtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttttttgtcatcgcttccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcttttttgtcatcgcttcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggcttttttgtcatcgctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggcttttttgtcatcgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttcgttttaccatcagcccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttgtagactatttgcacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggtttgtagactatttgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaactggtttgtagactac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttatgatggatgttgcctaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagattttacttccacctgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagcttctcagattttactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcaatttggaaagatgaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagaatcaaaaggaattgccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagtttcaaatcctttgttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtttcaaatcctttgttc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct tcagattttacttccacctggg 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct caggtggaagtaaaatctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggaagtaaaatctgagaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgcatggtcagtaaaagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtaaaatctgagaagcta 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct tcagattttacttccacctggg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tttctcagattttacttccacct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tttgcttttactgaccatgcgag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagcttctcagattttactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgctgggacgtacgggttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgacgtacgggttgggggaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cacgtacgggttgggggacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggaggctgaccttccagagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caggctgaccttccagagcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcctgctgctgctccgcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgtcagtaaaagcaaagacga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctcagtaaaagcaaagacgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagtaaaagcaaagacgggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctggaagcgatgacaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggaagcgatgacaaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caagcgatgacaaaaaagcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccgatgacaaaaaagccaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccttgaaaaataggccttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcttgaaaaataggccttgca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttgaaaaataggccttgcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaggccttgccttagccccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaaatagtctacaaaccaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaatagtctacaaaccagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagtctacaaaccagttgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctctacaaaccagttgaccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacaaaccagttgacctgaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaccagttgacctgagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccagttgacctgagcaagga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgagcaaggtgacctccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaggtgacctccaagtgtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cacctccaagtgtggctcata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaagtgtggctcattaggca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagtgtggctcattaggcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtgtggctcattaggcaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcattaggcaacatccatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gattaggcaacatccatcata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaggcaacatccatcataaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgcaacatccatcataaacca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaacatccatcataaaccaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcatccatcataaaccaggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccatcataaaccaggaggta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaccaggaggtggccaggta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cccaggtggaagtaaaatcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaagtaaaatctgagaagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtaaaatctgagaagcttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaatctgagaagcttgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaatctgagaagcttgacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatctgagaagcttgactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatctgagaagcttgacttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtctgagaagcttgacttcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggagaagcttgacttcaagga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagaagcttgacttcaaggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcttgacttcaaggacaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcttgacttcaaggacagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccttgacttcaaggacagaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttgacttcaaggacagagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgacttcaaggacagagtca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cacagagtccagtcgaagata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagagtccagtcgaagattga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcagtcgaagattgggtccca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagtcgaagattgggtcccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggaagattgggtccctggaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cattgggtccctggacaataa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggtccctggacaatatcaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccctggacaatatcacccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctggacaatatcacccacga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggacaatatcacccacgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaaagaataatgacccga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaagaataatgacccgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaagaataatgacccggca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgcccccgccctctgccccca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccccgccctctgcccccaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgcccccagctgctcctcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccccagctgctcctcgcaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctcctcgcagttcggttaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcgcagttcggttaattgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgcagttcggttaattggta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcagttcggttaattggtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccagttcggttaattggttaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagttcggttaattggttaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttcggttaattggttaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttcggttaattggttaatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcggttaattggttaatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcggttaattggttaatcaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggttaattggttaatcacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgttaattggttaatcactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttaattggttaatcacttaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaattggttaatcacttaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttggttaatcacttaaccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggttaatcacttaacctgca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgttaatcacttaacctgcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttaatcacttaacctgctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaatcacttaacctgcttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacttaacctgcttttgtcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcttaacctgcttttgtcaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttaacctgcttttgtcacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaacctgcttttgtcactca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaacctgcttttgtcactcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcctgcttttgtcactcggca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgcttttgtcactcggctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcttttgtcactcggcttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccttttgtcactcggctttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtcactcggctttggctcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctcactcggctttggctcgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttggctcgggacttcaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggctcgggacttcaaaatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctcgggacttcaaaatcaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggggacttcaaaatcagtgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggacttcaaaatcagtgata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcttcaaaatcagtgatggga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttcaaaatcagtgatgggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcaaaatcagtgatgggaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaatcagtgatgggagtaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaatcagtgatgggagtaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatcagtgatgggagtaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatcagtgatgggagtaagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcagtgatgggagtaagaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagtgatgggagtaagagcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtgatgggagtaagagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgatgggagtaagagcaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggatgggagtaagagcaaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct catgggagtaagagcaaatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgggagtaagagcaaattta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggggagtaagagcaaatttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggagtaagagcaaatttcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgagtaagagcaaatttcata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagtaagagcaaatttcatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtaagagcaaatttcatcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctaagagcaaatttcatctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttcatctttccaaattgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtctttccaaattgatgggta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctttccaaattgatgggtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttccaaattgatgggtgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtccaaattgatgggtgggca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaattgatgggtgggctagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gattgatgggtgggctagtaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttgatgggtgggctagtaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgatgggtgggctagtaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct catgggtgggctagtaataaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgggtgggctagtaataaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtagtaataaaatatttaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagtaataaaatatttaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtaataaaatatttaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctaataaaatatttaaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaataaaatatttaaaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gataaaatatttaaaaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaaaatatttaaaaaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaaaaaaaaacattcaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaaaaaacattcaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaacccgtacgtcccagcgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtcccccaacccgtacgtcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtcccccaacccgtacgtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgctctggaaggtcagcctcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggctctggaaggtcagcctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgcggagcagcagcaggctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgtctttgcttttactgacg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccgtctttgcttttactgag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcccgtctttgcttttactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttttgtcatcgcttccagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttttgtcatcgcttccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggcttttttgtcatcgcttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttggcttttttgtcatcgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaggcctatttttcaaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcaaggcctatttttcaagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggcaaggcctatttttcaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggggctaaggcaaggcctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctggtttgtagactatttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactggtttgtagactatttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtcaactggtttgtagactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggtcaactggtttgtagag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctcaggtcaactggtttgtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctcaggtcaactggttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccttgctcaggtcaactggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggaggtcaccttgctcagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacacttggaggtcaccttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgagccacacttggaggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcctaatgagccacacttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgcctaatgagccacactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttgcctaatgagccacacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatggatgttgcctaatgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgatggatgttgcctaatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttatgatggatgttgcctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggtttatgatggatgttgcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctggtttatgatggatgttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcctggtttatgatggatgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacctcctggtttatgatggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacctggccacctcctggttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagattttacttccacctggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcttctcagattttacttcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaagcttctcagattttacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtcaagcttctcagattttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagtcaagcttctcagatttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtcaagcttctcagattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaagtcaagcttctcagatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgaagtcaagcttctcagac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccttgaagtcaagcttctcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttccttgaagtcaagcttctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctgtccttgaagtcaagctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttctgtccttgaagtcaagcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctctgtccttgaagtcaagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactctgtccttgaagtcaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgactctgtccttgaagtcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcttcgactggactctgtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaatcttcgactggactctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgggacccaatcttcgactgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagggacccaatcttcgactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtccagggacccaatcttcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttattgtccagggacccaatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtgatattgtccagggaccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgggtgatattgtccagggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgtgggtgatattgtccagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacgtgggtgatattgtccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgggtcattattcttttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccgggtcattattctttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgccgggtcattattcttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgggggcagagggcgggggcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctgggggcagagggcggggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgaggagcagctgggggcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctgcgaggagcagctggggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttaaccgaactgcgaggagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccaattaaccgaactgcgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taccaattaaccgaactgcgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaccaattaaccgaactgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttaaccaattaaccgaactgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttaaccaattaaccgaactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattaaccaattaaccgaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgattaaccaattaaccgaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgattaaccaattaaccgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtgattaaccaattaaccgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagtgattaaccaattaaccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtgattaaccaattaacg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttaagtgattaaccaattaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttaagtgattaaccaattac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggttaagtgattaaccaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcaggttaagtgattaaccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagcaggttaagtgattaacg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagcaggttaagtgattaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaagcaggttaagtgattac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgacaaaagcaggttaagtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtgacaaaagcaggttaagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagtgacaaaagcaggttaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgagtgacaaaagcaggttac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgagtgacaaaagcaggttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgccgagtgacaaaagcaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagccgagtgacaaaagcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaagccgagtgacaaaagcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaagccgagtgacaaaagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgagccaaagccgagtgacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccgagccaaagccgagtgag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttgaagtcccgagccaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgattttgaagtcccgagccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctgattttgaagtcccgagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcactgattttgaagtcccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcactgattttgaagtccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcccatcactgattttgaagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcccatcactgattttgaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctcccatcactgattttgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttactcccatcactgattttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttactcccatcactgatttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttactcccatcactgattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcttactcccatcactgatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctcttactcccatcactgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgctcttactcccatcactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctcttactcccatcacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttgctcttactcccatcag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatttgctcttactcccatcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatttgctcttactcccatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaatttgctcttactcccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaaatttgctcttactcccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgaaatttgctcttactccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgaaatttgctcttactcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatgaaatttgctcttactg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagatgaaatttgctcttacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagatgaaatttgctcttag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaatttggaaagatgaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacccatcaatttggaaagac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacccatcaatttggaaagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccacccatcaatttggaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcccacccatcaatttggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactagcccacccatcaattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttactagcccacccatcaatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttactagcccacccatcaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattactagcccacccatcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttattactagcccacccatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttattactagcccacccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttaaatattttattactac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttaaatattttattactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttttaaatattttattacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttttaaatattttattag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttttttaaatattttattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttttttaaatattttatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttttttttaaatattttac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttgaatgtttttttttac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttttgaatgtttttttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgctgggacgtacgggttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgacgtacgggttgggggaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cacgtacgggttgggggacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggaggctgaccttccagagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caggctgaccttccagagcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcctgctgctgctccgcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgtcagtaaaagcaaagacga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctcagtaaaagcaaagacgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagtaaaagcaaagacgggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctggaagcgatgacaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggaagcgatgacaaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caagcgatgacaaaaaagcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccgatgacaaaaaagccaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccttgaaaaataggccttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcttgaaaaataggccttgca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttgaaaaataggccttgcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaggccttgccttagccccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaaatagtctacaaaccaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaatagtctacaaaccagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagtctacaaaccagttgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctctacaaaccagttgaccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacaaaccagttgacctgaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaccagttgacctgagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccagttgacctgagcaagga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgagcaaggtgacctccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaggtgacctccaagtgtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cacctccaagtgtggctcata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaagtgtggctcattaggca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagtgtggctcattaggcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtgtggctcattaggcaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcattaggcaacatccatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gattaggcaacatccatcata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaggcaacatccatcataaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgcaacatccatcataaacca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaacatccatcataaaccaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcatccatcataaaccaggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccatcataaaccaggaggta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaccaggaggtggccaggta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cccaggtggaagtaaaatcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaagtaaaatctgagaagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtaaaatctgagaagcttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaatctgagaagcttgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaatctgagaagcttgacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatctgagaagcttgactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatctgagaagcttgacttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtctgagaagcttgacttcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggagaagcttgacttcaagga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagaagcttgacttcaaggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcttgacttcaaggacaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcttgacttcaaggacagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccttgacttcaaggacagaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttgacttcaaggacagagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgacttcaaggacagagtca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cacagagtccagtcgaagata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagagtccagtcgaagattga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcagtcgaagattgggtccca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagtcgaagattgggtcccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggaagattgggtccctggaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cattgggtccctggacaataa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggtccctggacaatatcaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccctggacaatatcacccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctggacaatatcacccacga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggacaatatcacccacgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaaagaataatgacccga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaagaataatgacccgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaagaataatgacccggca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgcccccgccctctgccccca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccccgccctctgcccccaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgcccccagctgctcctcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccccagctgctcctcgcaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctcctcgcagttcggttaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcgcagttcggttaattgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgcagttcggttaattggta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcagttcggttaattggtta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccagttcggttaattggttaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagttcggttaattggttaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttcggttaattggttaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttcggttaattggttaatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcggttaattggttaatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcggttaattggttaatcaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggttaattggttaatcacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgttaattggttaatcactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttaattggttaatcacttaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaattggttaatcacttaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttggttaatcacttaaccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggttaatcacttaacctgca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgttaatcacttaacctgcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttaatcacttaacctgctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaatcacttaacctgcttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacttaacctgcttttgtcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcttaacctgcttttgtcaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttaacctgcttttgtcacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaacctgcttttgtcactca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaacctgcttttgtcactcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcctgcttttgtcactcggca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgcttttgtcactcggctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcttttgtcactcggcttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccttttgtcactcggctttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtcactcggctttggctcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctcactcggctttggctcgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttggctcgggacttcaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggctcgggacttcaaaatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctcgggacttcaaaatcaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggggacttcaaaatcagtgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggacttcaaaatcagtgata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcttcaaaatcagtgatggga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttcaaaatcagtgatgggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcaaaatcagtgatgggaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaatcagtgatgggagtaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaatcagtgatgggagtaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaatcagtgatgggagtaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatcagtgatgggagtaagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcagtgatgggagtaagaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagtgatgggagtaagagcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtgatgggagtaagagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgatgggagtaagagcaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggatgggagtaagagcaaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct catgggagtaagagcaaatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgggagtaagagcaaattta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggggagtaagagcaaatttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggagtaagagcaaatttcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgagtaagagcaaatttcata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagtaagagcaaatttcatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtaagagcaaatttcatcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctaagagcaaatttcatctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttcatctttccaaattgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtctttccaaattgatgggta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctttccaaattgatgggtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttccaaattgatgggtgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtccaaattgatgggtgggca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaattgatgggtgggctagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gattgatgggtgggctagtaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttgatgggtgggctagtaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgatgggtgggctagtaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct catgggtgggctagtaataaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgggtgggctagtaataaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtagtaataaaatatttaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagtaataaaatatttaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtaataaaatatttaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctaataaaatatttaaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaataaaatatttaaaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gataaaatatttaaaaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaaaatatttaaaaaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaaaaaaaaacattcaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaaaaaacattcaaaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtcccccaacccgtacgtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgctctggaaggtcagcctcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggctctggaaggtcagcctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgcggagcagcagcaggctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgtctttgcttttactgacg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccgtctttgcttttactgag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcccgtctttgcttttactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttttgtcatcgcttccagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttttgtcatcgcttccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggcttttttgtcatcgcttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttggcttttttgtcatcgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaggcctatttttcaaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcaaggcctatttttcaagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggcaaggcctatttttcaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggggctaaggcaaggcctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctggtttgtagactatttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactggtttgtagactatttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtcaactggtttgtagactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggtcaactggtttgtagag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctcaggtcaactggtttgtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctcaggtcaactggttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccttgctcaggtcaactggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggaggtcaccttgctcagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacacttggaggtcaccttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgagccacacttggaggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcctaatgagccacacttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgcctaatgagccacactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttgcctaatgagccacacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatggatgttgcctaatgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgatggatgttgcctaatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttatgatggatgttgcctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggtttatgatggatgttgcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctggtttatgatggatgttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcctggtttatgatggatgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacctcctggtttatgatggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacctggccacctcctggttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagattttacttccacctggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcttctcagattttacttcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaagcttctcagattttacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtcaagcttctcagattttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagtcaagcttctcagatttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtcaagcttctcagattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaagtcaagcttctcagatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgaagtcaagcttctcagac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccttgaagtcaagcttctcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttccttgaagtcaagcttctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctgtccttgaagtcaagctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttctgtccttgaagtcaagcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctctgtccttgaagtcaagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactctgtccttgaagtcaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgactctgtccttgaagtcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcttcgactggactctgtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaatcttcgactggactctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgggacccaatcttcgactgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagggacccaatcttcgactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtccagggacccaatcttcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttattgtccagggacccaatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtgatattgtccagggaccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgggtgatattgtccagggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgtgggtgatattgtccagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacgtgggtgatattgtccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgggtcattattcttttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccgggtcattattctttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgccgggtcattattcttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgggggcagagggcgggggcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctgggggcagagggcggggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgaggagcagctgggggcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctgcgaggagcagctggggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttaaccgaactgcgaggagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccaattaaccgaactgcgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taccaattaaccgaactgcgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaccaattaaccgaactgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttaaccaattaaccgaactgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttaaccaattaaccgaactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattaaccaattaaccgaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgattaaccaattaaccgaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgattaaccaattaaccgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtgattaaccaattaaccgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagtgattaaccaattaaccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagtgattaaccaattaacg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttaagtgattaaccaattaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttaagtgattaaccaattac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggttaagtgattaaccaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcaggttaagtgattaaccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagcaggttaagtgattaacg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagcaggttaagtgattaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaagcaggttaagtgattac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgacaaaagcaggttaagtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtgacaaaagcaggttaagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagtgacaaaagcaggttaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgagtgacaaaagcaggttac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgagtgacaaaagcaggttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgccgagtgacaaaagcaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagccgagtgacaaaagcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaagccgagtgacaaaagcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaagccgagtgacaaaagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgagccaaagccgagtgacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccgagccaaagccgagtgag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttgaagtcccgagccaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgattttgaagtcccgagccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctgattttgaagtcccgagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcactgattttgaagtcccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcactgattttgaagtccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcccatcactgattttgaagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcccatcactgattttgaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctcccatcactgattttgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttactcccatcactgattttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttactcccatcactgatttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttactcccatcactgattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcttactcccatcactgatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctcttactcccatcactgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgctcttactcccatcactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctcttactcccatcacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttgctcttactcccatcag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatttgctcttactcccatcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatttgctcttactcccatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaatttgctcttactcccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaaatttgctcttactcccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgaaatttgctcttactccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgaaatttgctcttactcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatgaaatttgctcttactg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagatgaaatttgctcttacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagatgaaatttgctcttag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaatttggaaagatgaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacccatcaatttggaaagac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacccatcaatttggaaagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccacccatcaatttggaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcccacccatcaatttggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactagcccacccatcaattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttactagcccacccatcaatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttactagcccacccatcaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattactagcccacccatcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttattactagcccacccatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttattactagcccacccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttaaatattttattactac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttaaatattttattactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttttaaatattttattacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttttaaatattttattag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttttttaaatattttattc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttttttaaatattttatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttttttttaaatattttac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttttgaatgtttttttttac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttttgaatgtttttttttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgggacgtacgggttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaacccgtacgtcccagcgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acgtacgggttgggggaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtcccccaacccgtacgtcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgtacgggttgggggacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggctgaccttccagagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggctgaccttccagagcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcctgctgctgctccgcga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagtaaaagcaaagacga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtaaaagcaaagacgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaaaagcaaagacgggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggaagcgatgacaaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaagcgatgacaaaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcgatgacaaaaaagcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgacaaaaaagccaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgaaaaataggccttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaaaaataggccttgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaaaaataggccttgcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggccttgccttagccccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatagtctacaaaccaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatagtctacaaaccagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctacaaaccagttgaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctacaaaccagttgaccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaaccagttgacctgaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accagttgacctgagcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagttgacctgagcaagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgagcaaggtgacctccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggtgacctccaagtgtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctccaagtgtggctcata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtgtggctcattaggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgtggctcattaggcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtggctcattaggcaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cattaggcaacatccatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaggcaacatccatcata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcaacatccatcataaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caacatccatcataaacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acatccatcataaaccaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atccatcataaaccaggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcataaaccaggaggta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accaggaggtggccaggta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggtggaagtaaaatcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtaaaatctgagaagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaaatctgagaagcttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatctgagaagcttgaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatctgagaagcttgacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctgagaagcttgactta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgagaagcttgacttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgagaagcttgacttcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaagcttgacttcaagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagcttgacttcaaggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcttgacttcaaggacaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgacttcaaggacagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgacttcaaggacagaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacttcaaggacagagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacttcaaggacagagtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagagtccagtcgaagata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagtccagtcgaagattga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtcgaagattgggtccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcgaagattgggtcccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagattgggtccctggaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgggtccctggacaataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtccctggacaatatcaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctggacaatatcacccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggacaatatcacccacga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggacaatatcacccacgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaagaataatgacccga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaagaataatgacccgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagaataatgacccggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccccgccctctgccccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccgccctctgcccccaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcccccagctgctcctcga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccagctgctcctcgcaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctcgcagttcggttaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgcagttcggttaattgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcagttcggttaattggta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagttcggttaattggtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttcggttaattggttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttcggttaattggttaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcggttaattggttaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcggttaattggttaatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cggttaattggttaatcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggttaattggttaatcaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttaattggttaatcacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaattggttaatcactta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taattggttaatcacttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattggttaatcacttaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggttaatcacttaaccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttaatcacttaacctgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaatcacttaacctgcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatcacttaacctgctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatcacttaacctgcttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttaacctgcttttgtcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaacctgcttttgtcaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taacctgcttttgtcacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacctgcttttgtcactca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acctgcttttgtcactcga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgcttttgtcactcggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcttttgtcactcggctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttttgtcactcggcttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttgtcactcggctttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcactcggctttggctcga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cactcggctttggctcgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggctcgggacttcaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctcgggacttcaaaatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgggacttcaaaatcaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggacttcaaaatcagtgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacttcaaaatcagtgata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaaaatcagtgatggga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaaatcagtgatgggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaaatcagtgatgggaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatcagtgatgggagtaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatcagtgatgggagtaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcagtgatgggagtaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagtgatgggagtaagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtgatgggagtaagaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgatgggagtaagagcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgggagtaagagcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgggagtaagagcaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgggagtaagagcaaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggagtaagagcaaatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggagtaagagcaaattta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagtaagagcaaatttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagtaagagcaaatttcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtaagagcaaatttcata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaagagcaaatttcatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagagcaaatttcatcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagagcaaatttcatctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcatctttccaaattgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttccaaattgatgggta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttccaaattgatgggtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttccaaattgatgggtgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaaattgatgggtgggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attgatgggtgggctagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgatgggtgggctagtaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgggtgggctagtaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgggtgggctagtaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggtgggctagtaataaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggtgggctagtaataaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtaataaaatatttaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaataaaatatttaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taataaaatatttaaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aataaaatatttaaaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataaaatatttaaaaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaaatatttaaaaaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaatatttaaaaaaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaaaaaacattcaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaaaaacattcaaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaacccgtacgtcccagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtcccccaacccgtacgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtcccccaacccgtacg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgctctggaaggtcagcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggctctggaaggtcagcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgcggagcagcagcaggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgtctttgcttttactga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccgtctttgcttttactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcccgtctttgcttttac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttttgtcatcgcttcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttttttgtcatcgcttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggcttttttgtcatcgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttggcttttttgtcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaggcctatttttcaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcaaggcctatttttcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggcaaggcctatttttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggggctaaggcaaggcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctggtttgtagactattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactggtttgtagactatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtcaactggtttgtagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taggtcaactggtttgtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctcaggtcaactggtttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgctcaggtcaactggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccttgctcaggtcaactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggaggtcaccttgctca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcacacttggaggtcacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgagccacacttggagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcctaatgagccacactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgcctaatgagccacac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttgcctaatgagccaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatggatgttgcctaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgatggatgttgcctaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttatgatggatgttgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggtttatgatggatgttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctggtttatgatggatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcctggtttatgatggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacctcctggtttatgatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacctggccacctcctggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagattttacttccacctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcttctcagattttactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaagcttctcagatttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtcaagcttctcagattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagtcaagcttctcagatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagtcaagcttctcagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaagtcaagcttctcaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaagtcaagcttctcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccttgaagtcaagcttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttccttgaagtcaagcttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgtccttgaagtcaagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctgtccttgaagtcaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctctgtccttgaagtcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactctgtccttgaagtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgactctgtccttgaagtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcttcgactggactctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaatcttcgactggactc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggacccaatcttcgact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagggacccaatcttcgac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtccagggacccaatctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttattgtccagggacccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgatattgtccagggac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgggtgatattgtccagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgtgggtgatattgtcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacgtgggtgatattgtcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgggtcattattcttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccgggtcattattctttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgccgggtcattattcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggggcagagggcggggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgggggcagagggcggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgaggagcagctgggggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgcgaggagcagctggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttaaccgaactgcgagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccaattaaccgaactgcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taccaattaaccgaactgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaccaattaaccgaactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaaccaattaaccgaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttaaccaattaaccgaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tattaaccaattaaccgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgattaaccaattaaccga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgattaaccaattaaccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgattaaccaattaacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagtgattaaccaattaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagtgattaaccaattaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaagtgattaaccaatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttaagtgattaaccaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taggttaagtgattaacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcaggttaagtgattaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagcaggttaagtgattaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagcaggttaagtgatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaagcaggttaagtgatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgacaaaagcaggttaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgacaaaagcaggttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagtgacaaaagcaggtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgagtgacaaaagcaggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgagtgacaaaagcaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgccgagtgacaaaagcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagccgagtgacaaaagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaagccgagtgacaaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaagccgagtgacaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgagccaaagccgagtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccgagccaaagccgagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttgaagtcccgagccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgattttgaagtcccgagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgattttgaagtcccga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcactgattttgaagtcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcactgattttgaagtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcccatcactgattttgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcccatcactgattttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctcccatcactgattttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttactcccatcactgattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttactcccatcactgatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttactcccatcactgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcttactcccatcactga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctcttactcccatcactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgctcttactcccatcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgctcttactcccatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttgctcttactcccatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatttgctcttactcccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatttgctcttactccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaatttgctcttactccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaaatttgctcttactcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaaatttgctcttactc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgaaatttgctcttact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgaaatttgctcttac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagatgaaatttgctctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagatgaaatttgctctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaatttggaaagatgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacccatcaatttggaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcacccatcaatttggaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccacccatcaatttggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcccacccatcaatttgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactagcccacccatcaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttactagcccacccatcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttactagcccacccatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tattactagcccacccatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttattactagcccaccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttattactagcccaccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttaaatattttattact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttttaaatattttattac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttttaaatattttatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttttttaaatattttatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttttttaaatattttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttttttttaaatatttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttttttttaaatatttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttttgaatgttttttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttttgaatgtttttttt