WO IEC250016PCT CN 202311768062.2 2023-12-21 BYHEALTH CO., LTD. Postbiotic and use thereof in regulation of lipid metabolism 10 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tcgagcaggagatgggaacc 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct ctcgtggataccgcaagattc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ggtgtgggcagacgatacaa 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct acgggagattgtctgacagg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tcgagcaggagatgggaacc 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct ctcgtggataccgcaagattc 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct gcaagtgtgacatctggtttc 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct tgagaggaactttgtctccct 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tttccagctctccgctcaac 22 DNA PAT source 1..22 mol_type other DNA organism synthetic construct cgttggaagtaaattttgcccg