WO PCT/CN2023/116571 2023-09-01 RIGERNA THERAPEUTICS CO., LTD. DOUBLE-STRANDED OLIGONUCLEOTIDE AND CONJUGATE FOR INHIBITING EXPRESSION OF C3 GENES, AND USES THEREOF 424 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtccacgacttcccaggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccacgacttcccaggcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacgacttcccaggcaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgctgtccagtgagaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgtccagtgagaagact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagagcgggtacctcttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcgggtacctcttcatcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagacagacaagaccatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggatcttcaccgtcaacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgtcaaccacaagctgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgtcaaccacaagctgcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cggtcaagcaggactcctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcaagcaggactccttgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caagcaggactccttgtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgggacattccggaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggacattccggaactcgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtggaagatccgagcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtggaagatccgagccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaagatccgagcctacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagatccgagcctactat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatccgagcctactatgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtttgaggtgaaggagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcccagtttcgaggtcata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagtttcgaggtcatagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtttcgaggtcatagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttcgaggtcatagtgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgaggtcatagtggagcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtggagcctacagagaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagagaaattctactacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaattctactacatctata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaactgcctttgtcatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaactgcctttgtcatctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctttgtcatcttcgggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgaatccctcaagcgcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggcagtgacatggtgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgacctctccctaccaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaatgccctttgacctcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctttgacctcatggtgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacctcatggtgttcgtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcatggtgttcgtgacga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatggtgttcgtgacgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtgcagtctctaaccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccagaagcccttgagcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagaagcccttgagcatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcatcacggtgcgcacgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cggtgcgcacgaagaagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgtgggcaactccaacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgtgggcaactccaacaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgggcaactccaacaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaactccaacaattacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctccaacaattacctgcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggggagaccctcaacgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggagaccctcaacgtcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagaccctcaacgtcaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccctcaacgtcaacttcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaacttcctcctgcgaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaggccaagatccgctact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agatccgctactacaccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgctactacacctacctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctactacacctacctgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgtgtgggtggacgtcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggctcgctggtggtaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccctgaagatagagggtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgggagaaccccatgaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggagaaccccatgaggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagaaccccatgaggttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgctgcaactacatcaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagtaacctggatgagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaacctggatgaggacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcagaagagaacatcgttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagaacatcgtttcccgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccgaagtgagttcccaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgaagctcatgaatatatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagctcatgaatatattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccttcgaggtcacagtaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttcgaggtcacagtaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcacagtaatgcaggactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctgcggctaccctactct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcggctaccctactctgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggctaccctactctgttgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctaccctactctgttgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accctactctgttgttcga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccctactctgttgttcgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctactctgttgttcgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgaaacgagcaggtggaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaacgagcaggtggaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgagcaggtggaaatccga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caattaccggcagaaccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggtggaactactccacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtggaactactccacaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaactactccacaatcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgtcaccagcagaccgtaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caccagcagaccgtaacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaagtccctgaaggtcgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcgtgccggaaggaatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgtgccggaaggaatcaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgccggaaggaatcagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccggaaggaatcagaatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cggaaggaatcagaatgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcagacctcagtgaccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaccagaattctcctgcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaacggctgaagcacctca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgctgtgcattacctggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcattacctggatgaaacg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttggagctcatcaagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcagctggccttcagacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgcctacgtggtcaaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctacgtggtcaaggtctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgtggtcaaggtcttctct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctctggctgtcaacctcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctctgcggggctgttaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgttaaatggctgatcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaggatgcgcccgtgata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggccctcacggcctttgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcacggcctttgttctca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctttgttctcatctcgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgaagccaactacatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaactacatgaacctaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctacagagatcctacact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgaccacagccaaagata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccacagccaaagataagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccaaagataagaaccgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccacatcctatgccctct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccacatcctatgccctctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggccctactgcagctaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctactgcagctaaaagact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagctaaaagactttgact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctaaaagactttgacttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgtcgtgcgttggctcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgtcgtgcgttggctcaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgtgcgttggctcaatgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgttggctcaatgaacaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggctcaatgaacagagata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcaatgaacagagatact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaccttcatggtgttcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caccttcatggtgttccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtgttccaagccttggct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgtatccactgggaatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcctcctgcgatcagaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcgatcagaagagaccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatcagaagagaccaagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttcacagtcacagctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacaatgtaccatgctaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaccatgctaaggccaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caactcacctgtaataaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctgtaataaattcgacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaataaattcgacctcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgacctcaaggtcaccata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacctcaaggtcaccataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaggtcaccataaaacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagcaccggaaacagaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaccggaaacagaaaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcctcaggatgccaagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggatgccaagaacacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgccaagaacactatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaagaacactatgatcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaacactatgatccttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagaccaggatgccactat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaggatgccactatgtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggatgccactatgtcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggatgccactatgtctata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgccactatgtctatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttgacagatacatctcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacagatacatctccaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagatacatctccaagtat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agatacatctccaagtatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatacatctccaagtatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaagtatgagctggacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggacaaagccttctccgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacaaagccttctccgata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccttctccgataggaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgataggaacaccctcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gataggaacaccctcatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggacaaggtctcacact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctttcaaagttcaccaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttcaaagttcaccaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtcaaggtctacgccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcaaggtctacgcctatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggtctacgcctattacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgtacccggttctacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtacccggttctaccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccggaaaaggaggatggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cggaaaaggaggatggaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaggatggaaagctgaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccgctgtgctgaggagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgctgtgctgaggagaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgctgtgctgaggagaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgctgaggagaattgctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgaggagaattgcttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagaattgcttcatacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagaattgcttcatacaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgagccaggagtggacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaggagtggactatgtgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggagtggactatgtgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagtggactatgtgtaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagtggactatgtgtacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtggactatgtgtacaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaatgactttgacgagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gactttgacgagtacatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actttgacgagtacatcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacgagtacatcatggcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcaagtcaggctcggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggctcggatgaggtgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctcggatgaggtgcaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgttcatcagccccatcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggggtctctcctccgattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgatttctggggagagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcagctacatcatcggga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctacatcatcgggaagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgaggaggacgaatgcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgaggaggacgaatgccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttgggtgccccaactga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcctgggaagtcgtggacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgcctgggaagtcgtggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttgcctgggaagtcgtgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttctcactggacagcacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agtcttctcactggacagcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaagaggtacccgctctgca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggatgaagaggtacccgctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agatggtcttgtctgtctgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggttgacggtgaagatccga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agcagcttgtggttgacggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagcagcttgtggttgacggt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aaggagtcctgcttgaccggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct acaaggagtcctgcttgaccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agacaaggagtcctgcttgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agttccggaatgtcccaagac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct acgagttccggaatgtcccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aggctcggatcttccactggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggctcggatcttccactgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagtaggctcggatcttccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atagtaggctcggatcttcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcatagtaggctcggatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactccttcacctcaaactca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgacctcgaaactgggcag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct actatgacctcgaaactgggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cactatgacctcgaaactggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccactatgacctcgaaactg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aggctccactatgacctcgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttctctgtaggctccactat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atgtagtagaatttctctgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatagatgtagtagaatttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agatgacaaaggcagttccct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aagatgacaaaggcagttccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atcccgaagatgacaaaggca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atgcgcttgagggattcaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcaccatgtcactgcctgag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctggtagggagaggtcacga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atgaggtcaaagggcattcct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aacaccatgaggtcaaagggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacgaacaccatgaggtcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgtcacgaacaccatgaggt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcgtcacgaacaccatgagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgggttagagactgcacagtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atgctcaagggcttctggctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatgctcaagggcttctggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcgtgcgcaccgtgatgctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcttcttcgtgcgcaccgtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgttggagttgcccacggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct attgttggagttgcccacggt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aattgttggagttgcccacgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aggtaattgttggagttgccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atgcaggtaattgttggagtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgacgttgagggtctccccgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgacgttgagggtctccccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agttgacgttgagggtctccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aggaagttgacgttgagggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct attcgcaggaggaagttgacg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agtagcggatcttggcctcgt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggtgtagtagcggatcttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaggtaggtgtagtagcgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atcaggtaggtgtagtagcgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgacgtccacccacacggag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttaccaccagcgagcccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaccctctatcttcagggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct acctcatggggttctcccgca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aacctcatggggttctcccgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agaacctcatggggttctccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtgatgtagttgcagcagtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcctcatccaggttactcctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atgtcctcatccaggttactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aaacgatgttctcttctgcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcgggaaacgatgttctctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctgggaactcacttcgggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aatatattcatgagcttcgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aaatatattcatgagcttcgt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttactgtgacctcgaaggggt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct attactgtgacctcgaagggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aagtcctgcattactgtgacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agagtagggtagccgcaggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aacagagtagggtagccgcag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct acaacagagtagggtagccgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aacaacagagtagggtagccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgaacaacagagtagggtag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcgaacaacagagtagggta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttcgaacaacagagtagggt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttccacctgctcgtttcgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atttccacctgctcgtttcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcggatttccacctgctcgtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggttctgccggtaattgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtggagtagttccaccctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct attgtggagtagttccaccct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggattgtggagtagttccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttacggtctgctggtgacgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggttacggtctgctggtgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct acgaccttcagggacttcctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgattccttccggcacgacct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctgattccttccggcacgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttctgattccttccggcacga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcattctgattccttccggca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcattctgattccttccggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggtcactgaggtctgcagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgcaggagaattctggtctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaggtgcttcagccgttccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atccaggtaatgcacagcgat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgtttcatccaggtaatgcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcttgatgagctccaaggcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtctgaaggccagctgctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct accttgaccacgtaggcggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aagaccttgaccacgtaggcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agagaagaccttgaccacgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atgaggttgacagccagagag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atttaacagccccgcagagga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aggatcagccatttaacagcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcacgggcgcatcctcctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aacaaaggccgtgagggccat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgagaacaaaggccgtgaggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agcgagatgagaacaaaggcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcatgtagttggcttcaagga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtaggttcatgtagttggct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agtgtaggatctctgtaggtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatctttggctgtggtcagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcttatctttggctgtggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agcggttcttatctttggctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agagggcataggatgtggcct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aagagggcataggatgtggcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttagctgcagtagggccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agtcttttagctgcagtaggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agtcaaagtcttttagctgca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aaagtcaaagtcttttagctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgagccaacgcacgacggga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct attgagccaacgcacgacggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcattgagccaacgcacgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctgttcattgagccaacgca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatctctgttcattgagccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agtatctctgttcattgagcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggaacaccatgaaggtggcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggaacaccatgaaggtggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agccaaggcttggaacaccat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agattcccagtggatacggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttctgatcgcaggaggctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggtctcttctgatcgcagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccttggtctcttctgatcgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagctgtgactgtgaaaccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttagcatggtacattgtcacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggccttagcatggtacat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atttattacaggtgagttgat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aggtcgaatttattacaggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgaggtcgaatttattacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatggtgaccttgaggtcgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttatggtgaccttgaggtcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggttttatggtgaccttgag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttctgtttccggtgctggtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttttctgtttccggtgctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcttggcatcctgaggcctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagtgttcttggcatcctgag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcatagtgttcttggcatcct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aggatcatagtgttcttggca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaggatcatagtgttcttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atagtggcatcctggtctccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agacatagtggcatcctggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagacatagtggcatcctggt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatagacatagtggcatcctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atatagacatagtggcatcct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggagatgtatctgtcaacac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct acttggagatgtatctgtcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atacttggagatgtatctgtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct catacttggagatgtatctgt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcatacttggagatgtatctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtccagctcatacttggag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atcggagaaggctttgtccag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcggagaaggctttgtcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttcctatcggagaaggctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atgagggtgttcctatcggag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatgagggtgttcctatcgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agtgtgagaccttgtccaggt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct attggtgaactttgaaagcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattggtgaactttgaaagct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggcgtagaccttgactgct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aataggcgtagaccttgactg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtaataggcgtagaccttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggtagaaccgggtacagctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atggtagaaccgggtacagct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttccatcctccttttccggat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttccatcctccttttccgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttcagctttccatcctcct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttctcctcagcacagcggcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct attctcctcagcacagcggca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aattctcctcagcacagcggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aagcaattctcctcagcacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaagcaattctcctcagcac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtatgaagcaattctcctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgtatgaagcaattctcct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagtccactcctggctcacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct acacatagtccactcctggct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacacatagtccactcctggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtacacatagtccactcctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtacacatagtccactcct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttgtacacatagtccactc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactcgtcaaagtcattggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatgtactcgtcaaagtcat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atgatgtactcgtcaaagtca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggccatgatgtactcgtcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atccgagcctgacttgatggt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcacctcatccgagcctgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct acctgcacctcatccgagcct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgatggggctgatgaacgtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aaatcggaggagagaccccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttctctccccagaaatcggag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcccgatgatgtagctgaggt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccttcccgatgatgtagctg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggcattcgtcctcctcgggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttggcattcgtcctcctcggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagttggggcacccaaagac