US YDBL-0005PCTUS US 63/346,416 2022-05-27 Cheng-Yao CHEN Cheng-Yao CHEN METHOD, KIT AND SYSTEM FOR DUAL LABELING OF NUCLEIC ACIDS 3 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct modified_base 1 mod_base OTHER note uracil misc_feature 1 note RNA misc_feature 2..45 note DNA tctcggcctggcacaggtccgtctcagtgctgcggcgaccaccga 15 DNA PAT source 1..15 mol_type other DNA organism synthetic construct tgtgccaggccgaga 47 DNA PAT source 1..47 mol_type other DNA organism synthetic construct modified_base 1 mod_base OTHER note uracil misc_feature 1 note RNA misc_feature 2..47 note DNA tctcggcctggcacaggtccgtctcagtgctgcggcgaccaccgagg