en 006_BW02_WO03_AGT 上海舶望制药有限公司 Argo Biopharmaceuticals COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF ANGIOTENSINOGEN (AGT) PROTEIN 655 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgtcatccacaatgagagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcatccacaatgagagtaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatccacaatgagagtaccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtccacaatgagagtacctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttcttgggcttccgtatata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttgggcttccgtatatatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgggcttccgtatatatgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcttccgtatatatggcata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcttccgtatatatggcatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgtatatatggcatgcacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttccttggaaggacaagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagaagattgacaggttcata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatgcaggctgtgacaggata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggagttctgggtggacaacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaacagcacctcagtgtcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggggtctcactttccagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcactttccagcaaaactca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccagcaaaactccctcaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcaaaactccctcaactga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggagctgaacctgcaaaaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgaacctgcaaaaattgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggaaccgcccattcctgttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaccgcccattcctgtttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttcctgtttgctgtgtatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgtttgctgtgtatgatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgtttgctgtgtatgatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttgctgtgtatgatcaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcccaccttttcttctaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccttttcttctaatgagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccttttcttctaatgagtca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgtttctccttggtctaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttctccttggtctaagtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtttgctgggtttattttaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttgctgggtttattttaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttgctgggtttattttagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggggtttattttagagaatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggtttattttagagaatgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggcaagaaccagtgtttaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcaagaaccagtgtttagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaagaaccagtgtttagcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgttccaaaaagaattcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttccaaaaagaattccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttccaaaaagaattccaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaaaaagaattccaaccgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaagaattccaaccgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaaccgaccagcttgtttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaccgaccagcttgtttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggaccagcttgtttgtgaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccagcttgtttgtgaaacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcatccacaatgagagtaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgggcttccgtatatatgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgtttgctgtgtatgatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtttgctgggtttattttaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccagcttgtttgtgaaacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcccaccttttcttctaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccttttcttctaatgagtca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggggtttattttagagaatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttccaaaaagaattccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttccaaaaagaattccaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct catccacaatgagagtaccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttcttgggcttccgtatata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct catgcaggctgtgacaggata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgaacctgcaaaaattgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccttttcttctaatgagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccgtttctccttggtctaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct actgttccaaaaagaattcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caaaaagaattccaaccgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaccagcttgtttgtgaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgtcatccacaatgagagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtccacaatgagagtacctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agggtctcactttccagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgtttgctgtgtatgatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctgtgtatgatcaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttctccttggtctaagtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaagaaccagtgtttagcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaaaaagaattccaaccgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caaccgaccagcttgtttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccttttcttctaatgagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacctttctttctagcgagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccttttcttctaatgagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgtttctccttggtctaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgtttctccttggtctaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaaaaagaattccaaccgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttttcttctaatgagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagcttgtttgtgaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttctccttggtctaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaagaattccaaccgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccaccttttcttctaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttttcttctaatgagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagcttgtttgtgaaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttctccttggtctaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaagaattccaaccgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccaccttttcttctaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactctcattgtggatgacgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtactctcattgtggatgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggtactctcattgtggatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaggtactctcattgtggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatatacggaagcccaagaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcatatatacggaagcccaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccatatatacggaagcccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgccatatatacggaagcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcatgccatatatacggaagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtgcatgccatatatacgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcttgtccttccaaggaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgaacctgtcaatcttctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcctgtcacagcctgcatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgttgtccacccagaactcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagacactgaggtgctgttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctggaaagtgagacccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgagttttgctggaaagtgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttgagggagttttgctggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagttgagggagttttgctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatttttgcaggttcagctcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaatttttgcaggttcagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaacaggaatgggcggttcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaacaggaatgggcggttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcatacacagcaaacaggaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatcatacacagcaaacagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgatcatacacagcaaacac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctttgatcatacacagcaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattagaagaaaaggtgggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactcattagaagaaaaggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgactcattagaagaaaaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttagaccaaggagaaacgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacttagaccaaggagaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttaaaataaacccagcaaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctaaaataaacccagcaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttctaaaataaacccagcaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcattctctaaaataaacccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccattctctaaaataaaccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctaaacactggttcttgccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgctaaacactggttcttgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgctaaacactggttcttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggaattctttttggaacagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggaattctttttggaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttggaattctttttggaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcggttggaattctttttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtcggttggaattctttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaacaagctggtcggttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaaacaagctggtcggttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttcacaaacaagctggtcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtttcacaaacaagctggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtactctcattgtggatgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccatatatacggaagcccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatcatacacagcaaacagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttaaaataaacccagcaaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtttcacaaacaagctggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattagaagaaaaggtgggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgactcattagaagaaaaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcattctctaaaataaacccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggaattctttttggaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttggaattctttttggaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggtactctcattgtggatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatatacggaagcccaagaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcctgtcacagcctgcatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaatttttgcaggttcagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactcattagaagaaaaggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttagaccaaggagaaacgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggaattctttttggaacagt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtcggttggaattctttttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttcacaaacaagctggtcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactctcattgtggatgacga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaggtactctcattgtggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctggaaagtgagaccct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgatcatacacagcaaacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctttgatcatacacagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacttagaccaaggagaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgctaaacactggttcttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcggttggaattctttttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaaacaagctggtcggttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactcattagaagaaaaggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactcattagaagaaaaggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactcattagaagaaaaggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttagaccaaggagaaacgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttagaccaaggagaaacgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcggttggaattctttttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactcattagaagaaaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttcacaaacaagctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttagaccaaggagaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcggttggaattcttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tattagaagaaaaggtggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aactcattagaagaaaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtttcacaaacaagctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttagaccaaggagaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcggttggaattcttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattagaagaaaaggtggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgtcatccacaatgagagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatccacaatgagagtaccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtccacaatgagagtacctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttcttgggcttccgtatata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttgggcttccgtatatatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgggcttccgtatatatgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcttccgtatatatggcata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcttccgtatatatggcatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgtatatatggcatgcacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttccttggaaggacaagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagaagattgacaggttcata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gatgcaggctgtgacaggata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggagttctgggtggacaacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaacagcacctcagtgtcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggggtctcactttccagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcactttccagcaaaactca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccagcaaaactccctcaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagcaaaactccctcaactga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggagctgaacctgcaaaaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgaacctgcaaaaattgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggaaccgcccattcctgttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaccgcccattcctgtttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttcctgtttgctgtgtatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgtttgctgtgtatgatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgtttgctgtgtatgatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttgctgtgtatgatcaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcccaccttttcttctaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccttttcttctaatgagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccttttcttctaatgagtca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgtttctccttggtctaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttctccttggtctaagtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtttgctgggtttattttaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttgctgggtttattttaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttgctgggtttattttagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggggtttattttagagaatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggtttattttagagaatgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggcaagaaccagtgtttaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcaagaaccagtgtttagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaagaaccagtgtttagcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgttccaaaaagaattcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttccaaaaagaattccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttccaaaaagaattccaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaaaaagaattccaaccgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaaaagaattccaaccgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaaccgaccagcttgtttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaaccgaccagcttgtttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggaccagcttgtttgtgaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccagcttgtttgtgaaacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcatccacaatgagagtaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactctcattgtggatgacgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggtactctcattgtggatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaggtactctcattgtggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatatacggaagcccaagaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcatatatacggaagcccaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccatatatacggaagcccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgccatatatacggaagcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcatgccatatatacggaagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtgcatgccatatatacgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcttgtccttccaaggaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatgaacctgtcaatcttctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcctgtcacagcctgcatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgttgtccacccagaactcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagacactgaggtgctgttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctggaaagtgagacccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgagttttgctggaaagtgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttgagggagttttgctggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagttgagggagttttgctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatttttgcaggttcagctcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaatttttgcaggttcagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaacaggaatgggcggttcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaacaggaatgggcggttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcatacacagcaaacaggaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatcatacacagcaaacagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgatcatacacagcaaacac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctttgatcatacacagcaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattagaagaaaaggtgggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactcattagaagaaaaggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgactcattagaagaaaaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttagaccaaggagaaacgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacttagaccaaggagaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttaaaataaacccagcaaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctaaaataaacccagcaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttctaaaataaacccagcaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcattctctaaaataaacccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccattctctaaaataaaccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctaaacactggttcttgccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgctaaacactggttcttgcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgctaaacactggttcttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggaattctttttggaacagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggaattctttttggaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttggaattctttttggaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcggttggaattctttttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtcggttggaattctttttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaacaagctggtcggttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaaacaagctggtcggttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttcacaaacaagctggtcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtttcacaaacaagctggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtactctcattgtggatgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcatccacaatgagagtaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgggcttccgtatatatgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgtttgctgtgtatgatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtttgctgggtttattttaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccagcttgtttgtgaaacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcccaccttttcttctaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccttttcttctaatgagtca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggggtttattttagagaatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttccaaaaagaattccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttccaaaaagaattccaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct catccacaatgagagtaccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttcttgggcttccgtatata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct catgcaggctgtgacaggata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgaacctgcaaaaattgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccttttcttctaatgagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccgtttctccttggtctaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct actgttccaaaaagaattcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caaaaagaattccaaccgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaccagcttgtttgtgaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgtcatccacaatgagagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtccacaatgagagtacctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agggtctcactttccagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgtttgctgtgtatgatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctgtgtatgatcaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttctccttggtctaagtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaagaaccagtgtttagcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaaaaagaattccaaccgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caaccgaccagcttgtttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcccaccttttcttctaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttccaaaaagaattccaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccttttcttctaatgagtca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccagcttgtttgtgaaacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttccaaaaagaattccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtttgctgggtttattttaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccttttcttctaatgagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccgtttctccttggtctaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaccagcttgtttgtgaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caaaaagaattccaaccgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgtcatccacaatgagagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtccacaatgagagtacctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agggtctcactttccagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgtttgctgtgtatgatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctgtgtatgatcaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttctccttggtctaagtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaagaaccagtgtttagcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaaaaagaattccaaccgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caaccgaccagcttgtttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtactctcattgtggatgac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccatatatacggaagcccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatcatacacagcaaacagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttaaaataaacccagcaaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtttcacaaacaagctggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattagaagaaaaggtgggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgactcattagaagaaaaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcattctctaaaataaacccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggaattctttttggaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttggaattctttttggaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggtactctcattgtggatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatatacggaagcccaagaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcctgtcacagcctgcatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaatttttgcaggttcagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactcattagaagaaaaggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttagaccaaggagaaacgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggaattctttttggaacagt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtcggttggaattctttttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttcacaaacaagctggtcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactctcattgtggatgacga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaggtactctcattgtggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctggaaagtgagaccct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgatcatacacagcaaacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctttgatcatacacagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacttagaccaaggagaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgctaaacactggttcttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcggttggaattctttttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaaacaagctggtcggttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattagaagaaaaggtgggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttggaattctttttggaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgactcattagaagaaaaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtttcacaaacaagctggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggaattctttttggaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttaaaataaacccagcaaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactcattagaagaaaaggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttagaccaaggagaaacgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttcacaaacaagctggtcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtcggttggaattctttttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactctcattgtggatgacga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaggtactctcattgtggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctggaaagtgagaccct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgatcatacacagcaaacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctttgatcatacacagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacttagaccaaggagaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgctaaacactggttcttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcggttggaattctttttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaaacaagctggtcggttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgggcttccgtatatatgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgtttgctgtgtatgatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtttgctgggtttattttaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccagcttgtttgtgaaacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcccaccttttcttctaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccttttcttctaatgagtca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggggtttattttagagaatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttccaaaaagaattccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttccaaaaagaattccaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct catccacaatgagagtaccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttcttgggcttccgtatata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct catgcaggctgtgacaggata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgaacctgcaaaaattgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct actgttccaaaaagaattcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caaaaagaattccaaccgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaccagcttgtttgtgaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgtcatccacaatgagagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtccacaatgagagtacctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agggtctcactttccagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgtttgctgtgtatgatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctgtgtatgatcaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttctccttggtctaagtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaagaaccagtgtttagcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaaaaagaattccaaccgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caaccgaccagcttgtttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcccaccttttcttctaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gttccaaaaagaattccaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccttttcttctaatgagtca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccagcttgtttgtgaaacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggttccaaaaagaattccaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtttgctgggtttattttaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccttttcttctaatgagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccgtttctccttggtctaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaccagcttgtttgtgaaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caaaaagaattccaaccgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgtcatccacaatgagagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtccacaatgagagtacctga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agggtctcactttccagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgtttgctgtgtatgatcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctgtgtatgatcaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtttctccttggtctaagtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaagaaccagtgtttagcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caaccgaccagcttgtttgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaaccgaccagcttgtttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccttttcttctaatgagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacctttctttctagcgagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccttttcttctaatgagta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgtttctccttggtctaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgtttctccttggtctaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaaaaagaattccaaccgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttttcttctaatgagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagcttgtttgtgaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttctccttggtctaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaagaattccaaccgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccaccttttcttctaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttttcttctaatgagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagcttgtttgtgaaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttctccttggtctaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaagaattccaaccgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccaccttttcttctaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccatatatacggaagcccac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgatcatacacagcaaacagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttaaaataaacccagcaaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtttcacaaacaagctggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattagaagaaaaggtgggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgactcattagaagaaaaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcattctctaaaataaacccc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggaattctttttggaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttggaattctttttggaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taggtactctcattgtggatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatatacggaagcccaagaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatcctgtcacagcctgcatg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcaatttttgcaggttcagc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggaattctttttggaacagt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtcggttggaattctttttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttcacaaacaagctggtcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactctcattgtggatgacga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaggtactctcattgtggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctggaaagtgagaccct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgatcatacacagcaaacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctttgatcatacacagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacttagaccaaggagaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgctaaacactggttcttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcggttggaattctttttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaaacaagctggtcggttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattagaagaaaaggtgggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttggaattctttttggaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgactcattagaagaaaaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtttcacaaacaagctggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttggaattctttttggaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttaaaataaacccagcaaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactcattagaagaaaaggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttagaccaaggagaaacgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttcacaaacaagctggtcg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtcggttggaattctttttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactctcattgtggatgacga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaggtactctcattgtggac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttgctggaaagtgagaccct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgatcatacacagcaaacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctttgatcatacacagcaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacttagaccaaggagaaac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgctaaacactggttcttgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaaacaagctggtcggttg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaacaagctggtcggttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactcattagaagaaaaggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactcattagaagaaaaggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tactcattagaagaaaaggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttagaccaaggagaaacgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttagaccaaggagaaacgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcggttggaattctttttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactcattagaagaaaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttcacaaacaagctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttagaccaaggagaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcggttggaattcttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tattagaagaaaaggtggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aactcattagaagaaaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtttcacaaacaagctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttagaccaaggagaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcggttggaattcttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattagaagaaaaggtggg 2116 RNA PAT source 1..2116 mol_type mRNA organism Homo sapiens gaagaagctgccgttgttctgggtactacagcagaagggtatgcggaagcgagcaccccagtctgagatggctcctgccggtgtgagcctgagggccaccatcctctgcctcctggcctgggctggcctggctgcaggtgaccgggtgtacatacaccccttccacctcgtcatccacaatgagagtacctgtgagcagctggcaaaggccaatgccgggaagcccaaagaccccaccttcatacctgctccaattcaggccaagacatcccctgtggatgaaaaggccctacaggaccagctggtgctagtcgctgcaaaacttgacaccgaagacaagttgagggccgcaatggtcgggatgctggccaacttcttgggcttccgtatatatggcatgcacagtgagctatggggcgtggtccatggggccaccgtcctctccccaacggctgtctttggcaccctggcctctctctatctgggagccttggaccacacagctgacaggctacaggcaatcctgggtgttccttggaaggacaagaactgcacctcccggctggatgcgcacaaggtcctgtctgccctgcaggctgtacagggcctgctagtggcccagggcagggctgatagccaggcccagctgctgctgtccacggtggtgggcgtgttcacagccccaggcctgcacctgaagcagccgtttgtgcagggcctggctctctatacccctgtggtcctcccacgctctctggacttcacagaactggatgttgctgctgagaagattgacaggttcatgcaggctgtgacaggatggaagactggctgctccctgatgggagccagtgtggacagcaccctggctttcaacacctacgtccacttccaagggaagatgaagggcttctccctgctggccgagccccaggagttctgggtggacaacagcacctcagtgtctgttcccatgctctctggcatgggcaccttccagcactggagtgacatccaggacaacttctcggtgactcaagtgcccttcactgagagcgcctgcctgctgctgatccagcctcactatgcctctgacctggacaaggtggagggtctcactttccagcaaaactccctcaactggatgaagaaactatctccccggaccatccacctgaccatgccccaactggtgctgcaaggatcttatgacctgcaggacctgctcgcccaggctgagctgcccgccattctgcacaccgagctgaacctgcaaaaattgagcaatgaccgcatcagggtgggggaggtgctgaacagcattttttttgagcttgaagcggatgagagagagcccacagagtctacccaacagcttaacaagcctgaggtcttggaggtgaccctgaaccgcccattcctgtttgctgtgtatgatcaaagcgccactgccctgcacttcctgggccgcgtggccaacccgctgagcacagcatgaggccagggccccagaacacagtgcctggcaaggcctctgcccctggcctttgaggcaaaggccagcagcagataacaaccccggacaaatcagcgatgtgtcacccccagtctcccaccttttcttctaatgagtcgactttgagctggaaagcagccgtttctccttggtctaagtgtgctgcatggagtgagcagtagaagcctgcagcggcacaaatgcacctcccagtttgctgggtttattttagagaatgggggtggggaggcaagaaccagtgtttagcgcgggactactgttccaaaaagaattccaaccgaccagcttgtttgtgaaacaaaaaagtgttcccttttcaagttgagaacaaaaattgggttttaaaattaaagtatacatttttgcattgccttcggtttgtatttagtgtcttgaatgtaagaacatgacctccgtgtagtgtctgtaataccttagttttttccacagatgcttgtgatttttgaacaatacgtgaaagatgcaagcacctgaatttctgtttgaatgcggaaccatagctggttatttctcccttgtgttagtaataaacgtcttgccacaataagcctccaaaaa 1434 RNA PAT source 1..1434 mol_type mRNA organism Mus musculus atgactcccacgggggcaggcctgaaggccaccatcttctgcatcttgacctgggtcagcctgacggctggggaccgcgtatacatccaccccttccatctcctttaccacaacaagagcacctgcgcccagctggagaaccccagtgtggagacactcccagagtcaacgttcgagcctgtgcccattcaggccaagacctcccctgtgaatgagaagaccctgcatgatcagctcgtgctggccgccgagaagctagaggatgaggaccggaagcgggctgcccaggtcgcaatgatcgccaacttcgtgggcttccgcatgtacaagatgctgaatgaggcaggaagtggggccagtggggccatcctctcaccaccagctctctttggcaccctggtctctttctaccttggatccttagatcccacggccagccagctgcagacgctgctggatgtccctgtgaaggagggagactgcacctcccgactagatggacacaaggtcctcgctgccctgcgggccattcagggcttgctggtcacccagggtgggagcagcagccagacacccctgctacagtccattgtggtggggctcttcactgctccaggctttcgtctaaagcactcatttgttcagagcctggctctctttacccctgccctcttcccacgctctctggatttatccactgacccagttcttgccactgagaaaatcaacaggttcataaaggctgtgacagggtggaagatgaacttgccactggagggggtcagtacagacagcaccctacttttcaacacctacgttcacttccaaggaacgatgagaggtttctctcagctgcctggagtccatgaattctgggtggacaacagcatctcggtgtctgtgcccatgatctccggcactggcaacttccagcactggagtgacacccagaacaacttctccgtgacgtgcgtgcccctaggtgagagagccaccctgctgctcatccagccccactgcacctcagatctcgacagggtggaggccctcatcttccggaacgacctcctgacttggatagagaacccgcctcctcgggccatccgcctgactctgccccagctggaaatccgaggatcctacaatctgcaggacctgctggctgaggacaagctgcccacccttttgggtgcggaggcaaatctgaacaacattggtgacaccaacccccgagtgggagaggttctcaatagcatcctcctcgaactcaaagcaggagaggaggaacagccgaccacgtctgtccagcagcctggctcaccggaggcactggatgtgaccctgagcagccccttcctgttcgccatctacgagcaggactcaggcacgctgcactttctgggcagagtgaataacccccagagtgtggtgtga 1458 RNA PAT source 1..1458 mol_type mRNA organism Macaca fascicularis atgcagaagcgagcaccccagtccgagatggctcctgccagcgtgagcctgagggccaccatcctctgcctcctggcctgggctggcctggccacaggtgaccgggtgtacatacaccccttccacctcgtcatccacaatgagagtacctgtgagcagctggcaaaggccgatgctgggaagcccaaagatcccaccttcacacctgttccgatacaggccaagacgtctcctgtggatgaaaaggccctgcaggaccagctagtgctggttgccgcaaaactcgacaccgaggacaagttgagagccgcgatggtcgggatgctggccaacttcttgggcttccgtatatatggcatgcacagtgagctatggggcgtggtccatggggccaccatcctctccccaacggctgtctttggcaccctggcctctctctacctgggagcgttggaccacacagccgacaggctacaggcaatcctgggcgtcccttggaaggacaagaactgcacctcccggctggatgcgcacaaggtcctctctgccctgcaggctgtacagggcctgctggtggcccagggcagggctgacggccagtcccagctgctgttgtccacagtggtgggtctcttcacagccccagatctgcacctgaagcagccgtttgtgcagggcctggctctctatgcccctgtggtcctcccacgctctctggacttcacagacctggaagtcgctgctgagaagattgacaggttcatgcaggctgtgacaggatggaagattagcagccccctgacgggagccagtgcggacagcaccctggttttcaacacctacgtccatttccaagggaagatgagggacttcttcctgctggctgagccccaggagttctgggtggacaacagcacctcagtgtctgtccccatgctgtctggcgtgggcaccttccagcactggagcgacgcccaggacaacttctcagtgactcaagtgccctttactgagagcgcctgcttgctgctgattcagcctcactacgcctctgacctggacaaggtggagggtctcactttccagcaaaactccctcaactggatgaagaaactgtctccccgggccatccacctgaccatgccccgactggtgctgcgaggatcttatgacctgcaggacctgcttgcccaggctgagctgcccgccattctgggcaccgagctgaacctgcaaaaattgagcaatgacaacctcagggtggggaaggtgctgaacagcattctttttgaactcgaagcggatgagagagagcccacagagtctacccgacagctgaacaggcctgagttcttggaggtgaccctggaccgcccattcctgtttgctgtgtatgatcaaagtgccactgccctgcacttcctgggccgtgtggccaacccgctgagcccagcatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaaccgaccagcttgtttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaacaagctggtcggttgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaact 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaacg 17 RNA PAT source 1..17 mol_type other RNA organism synthetic construct agcttgtttgtgaaaca 18 RNA PAT source 1..18 mol_type other RNA organism synthetic construct cagcttgtttgtgaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagcttgtttgtgaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagcttgtttgtgaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcagcttgtttgtgaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagcttgtttgtgaaaca 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct accagcttgtttgtgaaaca 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct tccagcttgtttgtgaaaca 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct gccagcttgtttgtgaaaca 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct cccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aaccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taccagcttgtttgtgaaaca 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct cgaccagcttgtttgtgaaaca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ccgaccagcttgtttgtgaaaca 24 RNA PAT source 1..24 mol_type other RNA organism synthetic construct accgaccagcttgtttgtgaaaca 25 RNA PAT source 1..25 mol_type other RNA organism synthetic construct aaccgaccagcttgtttgtgaaaca 26 RNA PAT source 1..26 mol_type other RNA organism synthetic construct caaccgaccagcttgtttgtgaaaca 32 RNA PAT source 1..32 mol_type other RNA organism synthetic construct gaattccaaccgaccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtaaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgtttcacaaacaagctggtg 17 RNA PAT source 1..17 mol_type other RNA organism synthetic construct tgtttcacaaacaagct 18 RNA PAT source 1..18 mol_type other RNA organism synthetic construct tgtttcacaaacaagctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttcacaaacaagctgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttcacaaacaagctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttcacaaacaagctgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttcacaaacaagctgg 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct tgtttcacaaacaagctgga 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggc 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggta 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtcgg 24 RNA PAT source 1..24 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtcggt 25 RNA PAT source 1..25 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtcggtt 26 RNA PAT source 1..26 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtcggttg 32 RNA PAT source 1..32 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtcggttggaattc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtgtt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaact 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaacc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaacg 17 RNA PAT source 1..17 mol_type other RNA organism synthetic construct agcttgtttgtgaaaca 18 RNA PAT source 1..18 mol_type other RNA organism synthetic construct cagcttgtttgtgaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagcttgtttgtgaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagcttgtttgtgaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcagcttgtttgtgaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagcttgtttgtgaaaca 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct accagcttgtttgtgaaaca 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct tccagcttgtttgtgaaaca 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct gccagcttgtttgtgaaaca 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct cccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aaccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taccagcttgtttgtgaaaca 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct cgaccagcttgtttgtgaaaca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ccgaccagcttgtttgtgaaaca 24 RNA PAT source 1..24 mol_type other RNA organism synthetic construct accgaccagcttgtttgtgaaaca 25 RNA PAT source 1..25 mol_type other RNA organism synthetic construct aaccgaccagcttgtttgtgaaaca 26 RNA PAT source 1..26 mol_type other RNA organism synthetic construct caaccgaccagcttgtttgtgaaaca 32 RNA PAT source 1..32 mol_type other RNA organism synthetic construct gaattccaaccgaccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtaaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccagcttgtttgtgaaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgtttcacaaacaagctggtg 17 RNA PAT source 1..17 mol_type other RNA organism synthetic construct tgtttcacaaacaagct 18 RNA PAT source 1..18 mol_type other RNA organism synthetic construct tgtttcacaaacaagctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttcacaaacaagctgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttcacaaacaagctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttcacaaacaagctgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttcacaaacaagctgg 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct tgtttcacaaacaagctgga 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggc 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggta 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtcgg 24 RNA PAT source 1..24 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtcggt 25 RNA PAT source 1..25 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtcggtt 26 RNA PAT source 1..26 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtcggttg 32 RNA PAT source 1..32 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtcggttggaattc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtgtt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatttcacaaacaagctggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtttcacaaacaagctggtg 18 RNA PAT source 1..18 mol_type other RNA organism synthetic construct ccagcttgtttgtgaaac 18 RNA PAT source 1..18 mol_type other RNA organism synthetic construct gtttcacaaacaagctgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcgtttctccttggtctaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttagaccaaggagaaacgc