P130032 SG 10202402453U 2024-08-14 Nanyang Technological University A TOLL-LIKE RECEPTOR 4 (TLR4) AGONIST AND METHODS OF USE THEREOF 56 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct cactgtcgagtcgcgtcc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tcatccatggcgaactggtg 22 DNA PAT source 1..22 mol_type other DNA organism synthetic construct gtccccaaagggatgagaagtt 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ctcctccacttggtggtttg 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct cccatgatctggaagagacca 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct caaacttctgcctgacgagc 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct tgccaccttttgacagtgatg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tgatgtgctgctgcgagatt 22 DNA PAT source 1..22 mol_type other DNA organism synthetic construct acgagagttgcctggctactag 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct cctcatagatgctaccaaggcac 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct agaccctgcccattgaactg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ggcgggtctggtttgatgat 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct caccatatggctcggacacc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tcgagtgacaaacacgactg 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct ccacgtgttgagatcattgcc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tcactccagttaaggagccc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct cggccttccctacttcacaa 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct tgccattgcacaactcttttc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct cactcacctgctgctactca 22 DNA PAT source 1..22 mol_type other DNA organism synthetic construct gcttggtgacaaaaactacagc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tgtccacagctttgctgaat 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct gaagtgtggtagcgaggaagc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct cgtgggagatgtcctcaact 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct agatctctgctcggaccacc 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct acagcagcgtggagagatatg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct gttaagccggttagtcccgt 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tcacccggaaatacacgctc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ggcctcgaaagtaaccggaa 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct gctgtcatcgatttctcccct 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct gacaccttggtcttggagcttat 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct tccctgcatagaggtagttcc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tcaaggggttgaagctcaga 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct tgtccaacaatggcatcacct 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tgtgttccctcgaagccaaa 17 DNA PAT source 1..17 mol_type other DNA organism synthetic construct ctcgcctttgccgatcc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tctccatgtcgtcccagttg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tgggatcattgccctgtgag 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ggtgtctgaaggagggggta 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct accggaaggaaccatctcac 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct ggcaaaactgcaccttcacac 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct atcttgggagaatttgctgatgaaaggaatctg 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct caaccgatggacgtgtaaaccagccaggttttg 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct cattagatgtgctcttaagcagtttccaac 31 DNA PAT source 1..31 mol_type other DNA organism synthetic construct attgataaggattgccatttgaaatgtttag 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct catcaataccagcttctttcgagggaatac 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct tattcacagtctctcctttcagagctctgc 31 DNA PAT source 1..31 mol_type other DNA organism synthetic construct cgagggaatactagctcctaagggccattac 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct aaagagaatggtattgatgtattcacagtc 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct atcttgggagaatttgctgatgaaaggaatctg 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct caaccgatggacgtgtaaaccagccaggttttg 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct cattagatgtgctcttaagcagtttccaac 31 DNA PAT source 1..31 mol_type other DNA organism synthetic construct attgataaggattgccatttgaaatgtttag 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct catcaataccagcttctttcgagggaatac 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct tattcacagtctctcctttcagagctctgc 31 DNA PAT source 1..31 mol_type other DNA organism synthetic construct cgagggaatactagctcctaagggccattac 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct aaagagaatggtattgatgtattcacagtc