WO PCT/CN2023/133563 2023-11-23 CN 2023101335162 2023-02-17 Suzhou Siran Biotechnology Co.,Ltd. SIRNA FOR INHIBITING EXPRESSION OF PROGRAMMED CELL DEATH LIGAND-1 GENE, CONJUGATE THEREOF, PHARMACEUTICAL COMPOSITION THEREOF, AND USE THEREOF 28 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatttgctgtctttatatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgctgtctttatattca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agatgaggatatttgctgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagatgaggatatttgcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgaggatatttgctgtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatatttgctgtctttata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagaaagatgaggatatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaggatatttgctgtcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcaatgcctcaatttgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatttgctgtctttatata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agatgaggatatttgctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaggatatttgctgtctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aatataaagacagcaaatatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaatataaagacagcaaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct acagcaaatatcctcatcttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagcaaatatcctcatctttc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agacagcaaatatcctcatct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tataaagacagcaaatatcct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aatatcctcatctttctggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aaagacagcaaatatcctcat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aacaaattgaggcattgagtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tatataaagacagcaaatatc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcagcaaatatcctcatcttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagacagcaaatatcctcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttttctgctttctgtcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgacagaaagcagaaaacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagattagatcctgaggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcctcaggatctaatctcct