EVIA102PCT US 63/256,840 2021-10-18 EVIA LIFE SCIENCES INC. TAKAHIRO OCHIYA COMPOSITIONS AND METHODS OF USE THEREOF FOR TREATING LIVER FIBROSIS 20 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct acactttctatggctgcccc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct gtaatgcgtccaggaagcct 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ggcatcatcaccaactggga 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ttctcctggcaaagacggac 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct tcgtgcgtgacatcaaagaga 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tggctgccttcctcttcttg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct cagctcctacattgggtccc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct atgccacctcctgagatcct 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ctgttccagccatccttcat 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct agcactgtgttggcgtacag 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct gtttcagggtccaggtcagg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct gggggccatcatggtatctg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct agaggcatagagggacagca 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ctcaaggtcacggtcacgaa 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct gccacaggattccatacccaa 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct gaaaagcatgagccagcagg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ctgggcaggtctactttggg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct attctccccctgccaaatgg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ggcaatgccagggtacatag 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct actcttccagccttccttcc