01138-0043-00PCT US US 63/253,933 2021-10-08 REGULUS THERAPEUTICS INC. DRYGIN, Denis METHODS AND COMPOSITIONS FOR TREATMENT OF POLYCYSTIC KIDNEY DISEASE 30 23 RNA PAT misc_feature 1..23 note Synthetic: miR-17 source 1..23 mol_type other RNA organism synthetic construct caaagtgcttacagtgcaggtag 23 RNA PAT misc_feature 1..23 note Synthetic: miR-20a source 1..23 mol_type other RNA organism synthetic construct taaagtgcttatagtgcaggtag 23 RNA PAT misc_feature 1..23 note Synthetic: miR-20b source 1..23 mol_type other RNA organism synthetic construct caaagtgctcatagtgcaggtag 23 RNA PAT misc_feature 1..23 note Synthetic: miR-93 source 1..23 mol_type other RNA organism synthetic construct caaagtgctgttcgtgcaggtag 23 RNA PAT misc_feature 1..23 note Synthetic: miR-106a source 1..23 mol_type other RNA organism synthetic construct aaaagtgcttacagtgcaggtag 21 RNA PAT misc_feature 1..21 note Synthetic: miR-106b source 1..21 mol_type other RNA organism synthetic construct taaagtgctgacagtgcagat 14 RNA PAT misc_feature 1..14 note Synthetic: nucleobase sequence source 1..14 mol_type other RNA organism synthetic construct ctacctgcactgta 13 RNA PAT misc_feature 1..13 note Synthetic: nucleobase sequence source 1..13 mol_type other RNA organism synthetic construct ctacctgcactgt 12 RNA PAT misc_feature 1..12 note Synthetic: nucleobase sequence source 1..12 mol_type other RNA organism synthetic construct ctacctgcactg 11 RNA PAT misc_feature 1..11 note Synthetic: nucleobase sequence source 1..11 mol_type other RNA organism synthetic construct ctacctgcact 10 RNA PAT misc_feature 1..10 note Synthetic: nucleobase sequence source 1..10 mol_type other RNA organism synthetic construct ctacctgcac 11 RNA PAT misc_feature 1..11 note Synthetic: RG-NG-1004 modified_base 1..11 mod_base OTHER note S-cEt nucleosides source 1..11 mol_type other RNA organism synthetic construct taagcactttg 11 RNA PAT misc_feature 1..11 note Synthetic: RG-NG-1005 modified_base 1..2 mod_base OTHER note S-cEt nucleosides modified_base 3 mod_base OTHER note 2'-O-methyl nucleoside modified_base 5..7 mod_base OTHER note S-cEt nucleosides modified_base 8..9 mod_base OTHER note 2'-O-methyl nucleosides modified_base 10..11 mod_base OTHER note S-cEt nucleosides source 1..11 mol_type other RNA organism synthetic construct taagcactttg 15 RNA PAT modified_base 3 mod_base OTHER note thymine modified_base 5 mod_base OTHER note thymine misc_feature 1..15 note Synthetic: RG-NG-1018 modified_base 1..3 mod_base OTHER note 2'-O-methoxyethyl modified_base 4 mod_base OTHER note S-cEt nucleoside modified_base 5 mod_base OTHER note 2'-O-methoxyethyl modified_base 7..8 mod_base OTHER note S-cEt nucleoside modified_base 9 mod_base OTHER note 2'-O-methyl nucleoside modified_base 10..12 mod_base OTHER note 2'-fluoro nucleoside modified_base 13 mod_base OTHER note 2'-O-methyl nucleoside modified_base 14..15 mod_base OTHER note S-cEt nucleoside source 1..15 mol_type other RNA organism synthetic construct actgtaagcactttc 15 RNA PAT modified_base 3 mod_base OTHER note thymine misc_feature 1..15 note Synthetic: RG-NG-1019 modified_base 1..2 mod_base OTHER note S-cEt nucleosides modified_base 4..5 mod_base OTHER note S-cEt nucleosides modified_base 7..8 mod_base OTHER note S-cEt nucleosides modified_base 9 mod_base OTHER note 2'-O-methyl nucleoside modified_base 10..12 mod_base OTHER note 2'-fluoro nucleosides modified_base 13 mod_base OTHER note 2'-O-methyl nucleosides modified_base 14..15 mod_base OTHER note S-cEt nucleosides source 1..15 mol_type other RNA organism synthetic construct actgtaagcactttc 13 RNA PAT modified_base 1 mod_base OTHER note thymine modified_base 3 mod_base OTHER note thymine misc_feature 1..13 note Synthetic: RG-NG-1020 modified_base 1 mod_base OTHER note 2'-O-methoxyethyl modified_base 2 mod_base OTHER note S-cEt nucleoside modified_base 3 mod_base OTHER note 2'-O-methoxyethyl modified_base 5..6 mod_base OTHER note S-cEt nucleoside modified_base 7 mod_base OTHER note 2'-O-methyl nucleoside modified_base 8..10 mod_base OTHER note 2'-fluoro nucleosides modified_base 11 mod_base OTHER note 2'-O-methyl nucleoside modified_base 12..13 mod_base OTHER note S-cEt nucleoside source 1..13 mol_type other RNA organism synthetic construct tgtaagcactttc 11 RNA PAT modified_base 1 mod_base OTHER note thymine misc_feature 1..11 note Synthetic: RG-NG-1021 modified_base 1 mod_base OTHER note 2'-O-methoxyethyl modified_base 3..4 mod_base OTHER note S-cEt nucleoside modified_base 5 mod_base OTHER note 2'-O-methyl nucleoside modified_base 6..8 mod_base OTHER note 2'-fluoro nucleosides modified_base 9 mod_base OTHER note 2'-O-methyl nucleoside modified_base 10..11 mod_base OTHER note S-cEt nucleoside source 1..11 mol_type other RNA organism synthetic construct taagcactttc 11 RNA PAT modified_base 1 mod_base OTHER note thymine misc_feature 1..11 note Synthetic: RG-NG-1022 modified_base 1..2 mod_base OTHER note 2'-O-methoxyethyl modified_base 3..4 mod_base OTHER note S-cEt nucleoside modified_base 5 mod_base OTHER note 2'-O-methyl nucleoside modified_base 6..8 mod_base OTHER note 2'-fluoro nucleosides modified_base 9 mod_base OTHER note 2'-O-methyl nucleoside modified_base 10..11 mod_base OTHER note S-cEt nucleoside source 1..11 mol_type other RNA organism synthetic construct taagcactttc 10 RNA PAT modified_base 8 mod_base OTHER note thymine misc_feature 1..10 note Synthetic: RG-NG-1030 modified_base 1..2 mod_base OTHER note 2'-O-methyl nucleosides modified_base 3..6 mod_base OTHER note LNA modified_base 7 mod_base OTHER note 2'-O-methyl nucleosides modified_base 8 mod_base OTHER note LNA modified_base 10 mod_base OTHER note 2'-O-methyl nucleosides source 1..10 mol_type other RNA organism synthetic construct aagcactttc 11 RNA PAT misc_feature 1..11 note Synthetic: RG-NG-1004 modified_base 1..11 mod_base OTHER note S-cEt nucleosides source 1..11 mol_type other RNA organism synthetic construct taagcactttg 11 RNA PAT misc_feature 1..11 note Synthetic: RG-NG-1005 modified_base 1..2 mod_base OTHER note S-cEt nucleosides modified_base 3 mod_base OTHER note 2'-O-methyl nucleoside modified_base 5..7 mod_base OTHER note S-cEt nucleosides modified_base 8..9 mod_base OTHER note 2'-O-methyl nucleosides modified_base 10..11 mod_base OTHER note S-cEt nucleosides source 1..11 mol_type other RNA organism synthetic construct taagcactttg 15 RNA PAT modified_base 3 mod_base OTHER note thymine modified_base 5 mod_base OTHER note thymine misc_feature 1..15 note Synthetic: RG-NG-1018 modified_base 1..3 mod_base OTHER note 2'-O-methoxyethyl modified_base 4 mod_base OTHER note S-cEt nucleoside modified_base 5 mod_base OTHER note 2'-O-methoxyethyl modified_base 7..8 mod_base OTHER note S-cEt nucleoside modified_base 9 mod_base OTHER note 2'-O-methyl nucleoside modified_base 10..12 mod_base OTHER note 2'-fluoro nucleosides modified_base 13 mod_base OTHER note 2'-O-methyl nucleoside modified_base 14..15 mod_base OTHER note S-cEt nucleoside source 1..15 mol_type other RNA organism synthetic construct actgtaagcactttc 15 RNA PAT modified_base 3 mod_base OTHER note thymine misc_feature 1..15 note Synthetic: RG-NG-1019 modified_base 1..2 mod_base OTHER note S-cEt nucleosides modified_base 4..5 mod_base OTHER note S-cEt nucleosides modified_base 7..8 mod_base OTHER note S-cEt nucleosides modified_base 9 mod_base OTHER note 2'-O-methyl nucleoside modified_base 10..12 mod_base OTHER note 2'-fluoro nucleosides modified_base 13 mod_base OTHER note 2'-O-methyl nucleoside modified_base 14..15 mod_base OTHER note S-cEt nucleosides source 1..15 mol_type other RNA organism synthetic construct actgtaagcactttc 13 RNA PAT modified_base 1 mod_base OTHER note thymine modified_base 3 mod_base OTHER note thymine misc_feature 1..13 note Synthetic: RG-NG-1020 modified_base 1 mod_base OTHER note 2'-O-methoxyethyl modified_base 2 mod_base OTHER note S-cEt nucleoside modified_base 3 mod_base OTHER note 2'-O-methoxyethyl modified_base 5..6 mod_base OTHER note S-cEt nucleoside modified_base 7 mod_base OTHER note 2'-O-methyl nucleoside modified_base 8..10 mod_base OTHER note 2'-fluoro nucleosides modified_base 11 mod_base OTHER note 2'-O-methyl nucleoside modified_base 12..13 mod_base OTHER note S-cEt nucleoside source 1..13 mol_type other RNA organism synthetic construct tgtaagcactttc 11 RNA PAT modified_base 1 mod_base OTHER note thymine misc_feature 1..11 note Synthetic: RG-NG-1021 modified_base 1 mod_base OTHER note 2'-O-methoxyethyl modified_base 3..4 mod_base OTHER note S-cEt nucleoside modified_base 5 mod_base OTHER note 2'-O-methyl nucleoside modified_base 6..8 mod_base OTHER note 2'-fluoro nucleosides modified_base 9 mod_base OTHER note 2'-O-methyl nucleoside modified_base 10..11 mod_base OTHER note S-cEt nucleoside source 1..11 mol_type other RNA organism synthetic construct taagcactttc 11 RNA PAT modified_base 1 mod_base OTHER note thymine misc_feature 1..11 note Synthetic: RG-NG-1022 modified_base 1..2 mod_base OTHER note 2'-O-methoxyethyl modified_base 3..4 mod_base OTHER note S-cEt nucleoside modified_base 5 mod_base OTHER note 2'-O-methyl nucleoside modified_base 6..8 mod_base OTHER note 2'-fluoro nucleosides modified_base 9 mod_base OTHER note 2'-O-methyl nucleoside modified_base 10..11 mod_base OTHER note S-cEt nucleoside source 1..11 mol_type other RNA organism synthetic construct taagcactttc 19 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine modified_base 9 mod_base OTHER note thymine misc_feature 1..19 note Synthetic: RG-NG-1040 modified_base 1..2 mod_base OTHER note 2'-O-methoxyethyl modified_base 3 mod_base OTHER note S-cEt nucleoside modified_base 4..7 mod_base OTHER note 2'-O-methoxyethyl modified_base 8 mod_base OTHER note S-cEt nucleoside modified_base 9 mod_base OTHER note 2'-O-methoxyethyl modified_base 10 mod_base OTHER note DNA modified_base 11..12 mod_base OTHER note S-cEt nucleoside modified_base 13 mod_base OTHER note 2'-O-methyl nucleoside modified_base 14..16 mod_base OTHER note 2-fluoro nucleosides modified_base 17 mod_base OTHER note 2'-O-methyl nucleoside modified_base 18..19 mod_base OTHER note S-cEt nucleoside source 1..19 mol_type other RNA organism synthetic construct ctgcactgtaagcactttg 17 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..17 note Synthetic: RG-NG-1032 modified_base 1 mod_base OTHER note S-cEt nucleoside modified_base 2..5 mod_base OTHER note 2'-O-methoxyethyl modified_base 6 mod_base OTHER note S-cEt nucleoside modified_base 7 mod_base OTHER note 2'-O-methoxyethyl modified_base 8 mod_base OTHER note DNA modified_base 9..10 mod_base OTHER note S-cEt nucleoside modified_base 11 mod_base OTHER note 2'-O-methyl nucleoside modified_base 12..14 mod_base OTHER note 2-fluoro nucleosides modified_base 15 mod_base OTHER note 2'-O-methyl nucleoside modified_base 16..17 mod_base OTHER note S-cEt nucleoside source 1..17 mol_type other RNA organism synthetic construct gcactgtaagcactttg 10 RNA PAT misc_feature 1..10 note Synthetic: 5'N+1 modified_base 1..3 mod_base OTHER note S-cEt nucleosides modified_base 4 mod_base OTHER note 2'-O-methyl nucleoside modified_base 5..7 mod_base OTHER note 2'-fluoro nucleosides modified_base 8 mod_base OTHER note 2'-O-methyl nucleoside modified_base 9..10 mod_base OTHER note S-cEt nucleosides source 1..10 mol_type other RNA organism synthetic construct aagcacttta 10 RNA PAT misc_feature 1..10 note Synthetic: RG-NG-1030 modified_base 1..2 mod_base OTHER note 2'-O-methyl nucleosides modified_base 3..6 mod_base OTHER note LNA modified_base 7 mod_base OTHER note 2'-O-methyl nucleoside modified_base 8 mod_base OTHER note LNA modified_base 10 mod_base OTHER note 2'-O-methyl nucleoside source 1..10 mol_type other RNA organism synthetic construct modified_base 8 mod_base OTHER note thymine aagcactttc