53398803 CN 202411356805X 2024-09-26 Beijing Youcare Kechuang Pharmaceutical Technology Co., Ltd. GALNAC MONOMER COMPRISING RIBOSE RING OR DERIVATIVE STRUCTURE THEREOF AND USE THEREOF IN LIVER-TARGETED DELIVERY OF SMALL NUCLEIC ACID DRUGS 4 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1..6 mod_base OTHER note 2'-OMe modified_base 8 mod_base OTHER note 2'-OMe modified_base 12..16 mod_base OTHER note 2'-OMe modified_base 18..21 mod_base OTHER note 2'-OMe modified_base 7 mod_base OTHER note 2'-F modified_base 9..11 mod_base OTHER note 2'-F modified_base 17 mod_base OTHER note 2'-F modified_base 1..3 mod_base OTHER note The two adjacent nucleotides are linked by a phosphorothioate group ccttttcttctaatgagtcga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'- (E)-Vinylphosphonate modified_base 1 mod_base OTHER note 2'-OMe modified_base 1..3 mod_base OTHER note The two adjacent nucleotides are linked by a phosphorothioate group modified_base 2 mod_base OTHER note 2'-F modified_base 3..5 mod_base OTHER note 2'-OMe modified_base 6 mod_base OTHER note 2'-F modified_base 7..13 mod_base OTHER note 2'-OMe modified_base 14 mod_base OTHER note 2'-F modified_base 15 mod_base OTHER note 2'-OMe modified_base 16 mod_base OTHER note 2'-F modified_base 17..23 mod_base OTHER note 2'-OMe modified_base 21..23 mod_base OTHER note The two adjacent nucleotides are linked by a phosphorothioate group tcgactcattagaagaaaaggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccttttcttctaatgagtcga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tcgactcattagaagaaaaggtg