PCT-CN2021-072745 CN 202010304073.5 2020-04-17 Ruijin Hospital Affiliated to Shanghai APPLICATION OF THYROID HORMONES AND ITS ANALOGUES IN PREPARATION OF DRUGS FOR TREATING ALPHA-THALASSEMIA 30 429 DNA PAT misc_feature 1..429 note human- Globin gene sequence source 1..429 mol_type other DNA organism synthetic construct atgtctctgaccaagactgagaggaccatcattgtgtccatgtgggccaagatctccacgcaggccgacaccatcggcaccgagactctggagaggctcttcctcagccacccgcagaccaagacctacttcccgcacttcgacctgcacccggggtccgcgcagttgcgcgcgcacggctccaaggtggtggccgccgtgggcgacgcggtgaagagcatcgacgacatcggcggcgccctgtccaagctgagcgagctgcacgcctacatcctgcgcgtggacccggtcaacttcaagctcctgtcccactgcctgctggtcaccctggccgcgcgcttccccgccgacttcacggccgaggcccacgccgcctgggacaagttcctatcggtcgtatcctctgtcctgaccgagaagtaccgctga 18 DNA PAT misc_feature 1..18 note Human--actin-F source 1..18 mol_type other DNA organism synthetic construct ccaaccgcgagaagatga 20 DNA PAT misc_feature 1..20 note Human--actin-R source 1..20 mol_type other DNA organism synthetic construct ccagaggcgtacagggatag 17 DNA PAT misc_feature 1..17 note Human-HBA1/2-F source 1..17 mol_type other DNA organism synthetic construct aaggtcggcgcgcacgc 000 21 DNA PAT misc_feature 1..21 note Human-HBZ-F source 1..21 mol_type other DNA organism synthetic construct ggaccatcattgtgtccatgt 21 DNA PAT misc_feature 1..21 note Human-HBZ-R source 1..21 mol_type other DNA organism synthetic construct gggaagtaggtcttggtctgc 20 DNA PAT misc_feature 1..20 note Human-HBE1-F source 1..20 mol_type other DNA organism synthetic construct tgcatgtggatcctgagaac 19 DNA PAT misc_feature 1..19 note Human-HBE1-R source 1..19 mol_type other DNA organism synthetic construct cgacagcagacaccagctt 20 DNA PAT misc_feature 1..20 note Human-HBG1/2-F source 1..20 mol_type other DNA organism synthetic construct agcacctggatgatctcaag 20 DNA PAT misc_feature 1..20 note Human-HBG1/2-R source 1..20 mol_type other DNA organism synthetic construct aaacggtcaccagcacattt 19 DNA PAT misc_feature 1..19 note Human-HBD-F source 1..19 mol_type other DNA organism synthetic construct gatgcagttggtggtgagg 19 DNA PAT misc_feature 1..19 note Human-HBD-R source 1..19 mol_type other DNA organism synthetic construct gggttgcccataacagcat 20 DNA PAT misc_feature 1..20 note Human-HBB-F source 1..20 mol_type other DNA organism synthetic construct gcacgtggatcctgagaact 20 DNA PAT misc_feature 1..20 note Human-HBB-R source 1..20 mol_type other DNA organism synthetic construct cactggtggggtgaattctt 432 DNA PAT misc_feature 1..432 note Zebrafish - Globin gene sequence source 1..432 mol_type other DNA organism synthetic construct atgagtctttctgctaaagacaaggccgccgtgaggggcttctgggccaagattgccccaaagggagagcaaattggtaacgaggcgttttccagattgcttttggtgtaccctcagaccaagacctacttctcccactggaacgatctggcccccggctctccctctgtgaagaagcagggaaagaagatcgtcggtggactcggtctggctgttgataaaatcgacgaccttttcaacggcctgctgaacctcagtgaattgcacgcctttcagctgagagtcgaccctgctaacttcaagctcctgtctcactgtctgctggtggtgttcgccatgctcttccctgatgacttcaccgctgaggtccatctggccatcgacaagttcctggcaagagtggctttggctctgtctgacaaatatcgttaa 20 DNA PAT misc_feature 1..20 note Zebrafish--actin-F source 1..20 mol_type other DNA organism synthetic construct tgctgttttcccctccattg 19 DNA PAT misc_feature 1..19 note Zebrafish--actin-R source 1..19 mol_type other DNA organism synthetic construct ttctgtcccatgccaacca 21 DNA PAT misc_feature 1..21 note Zebrafish-hbae1-F source 1..21 mol_type other DNA organism synthetic construct ctgaggctgtcagcaaaatcg 21 DNA PAT misc_feature 1..21 note Zebrafish-hbae1-R source 1..21 mol_type other DNA organism synthetic construct gaacaaagtggccagaaccac 21 DNA PAT misc_feature 1..21 note Zebrafish-hbae3-F source 1..21 mol_type other DNA organism synthetic construct gctgatggatgacctgaaggg 21 DNA PAT misc_feature 1..21 note Zebrafish-hbae3-R source 1..21 mol_type other DNA organism synthetic construct ctcaggagtgaagtcgtctgg 21 DNA PAT misc_feature 1..21 note Zebrafish-hbae5-F source 1..21 mol_type other DNA organism synthetic construct tgctgaacctcagtgaattgc 21 DNA PAT misc_feature 1..21 note Zebrafish-hbae5-R source 1..21 mol_type other DNA organism synthetic construct ggaacttgtcgatggccagat 20 DNA PAT misc_feature 1..20 note Zebrafish-hbbe1-F source 1..20 mol_type other DNA organism synthetic construct tccacgtagatcccgacaac 20 DNA PAT misc_feature 1..20 note Zebrafish-hbbe1-R source 1..20 mol_type other DNA organism synthetic construct tactgtcttcccagagcgga 21 DNA PAT misc_feature 1..21 note Zebrafish-hbbe2-F source 1..21 mol_type other DNA organism synthetic construct ggactggacagagccatgaag 21 DNA PAT misc_feature 1..21 note Zebrafish-hbbe2-R source 1..21 mol_type other DNA organism synthetic construct gaggcaatcacgattgtcagg 20 DNA PAT misc_feature 1..20 note Zebrafish-hbbe3-F source 1..20 mol_type other DNA organism synthetic construct ttgtgtggacagctgaggag 20 DNA PAT misc_feature 1..20 note Zebrafish-hbbe3-R source 1..20 mol_type other DNA organism synthetic construct acggatagacgaccaagcat