IEC240186PCT CN 202311056610.9 2023-08-22 Leaderna Therapeutics, Ltd. Leaderna Therapeutics, Ltd. siRNA targeting AGT gene expression and conjugate and use thereof 351 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaggtgctgaacagcattttt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct gctcccaccttttcttctaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caccttttcttctaatgaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct ccagcttttcttctaatgaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct cgagcttttcttctaatgaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct agagtctatccaacagctta 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct agagtctactcaacagctta 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct agagtctacctaacagctta 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct gggtctcattttccagcaat 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct gggtctcacttttcagcaat 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct gggtctcactttctagcaat 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct aggtgctaaacagcattttt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct aggtgctgaatagcattttt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct aggtgctgaacagtattttt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct aggtgctgaacagcattttt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct aggtgctgaacagcatttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtgctgaacagcattttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtgctgaacagcatttta 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct gggtctcactttccagcaat 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct agagtctacccaacagctta 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct tctcccaccttttcttctaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct ctcccaccttttcttctaaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct ccaccttttcttctaatgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agggtctcactttccagcaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtctcactttccagcaat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagagtctacccaacagctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagtctacccaacagctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcccaccttttcttctaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct ccaccttttcttctaatgat 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct ctcccactttttcttctaaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct ctaccttttcttctaatgaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaggtgctgaacagcatttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcggatgagagagagcccaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggatgagagagagcccacag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagagagagcccacagagtct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agcccacagagtctacccaat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggatgagagagagcccacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcccacagagtctacccaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccacagagtctacccaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cccacagagtctacccaacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacagagtctacccaacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcccaccttttcttctaaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct cacccccagtctcccacctt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct acccccagtctcccaccttt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct cccccagtctcccacctttt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct ccccagtctcccaccttttt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct cccagtctcccaccttttct 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct ccagtctcccaccttttctt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct cagtctcccaccttttcttt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct agtctcccaccttttcttct 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct gtctcccaccttttcttcta 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct tcccaccttttcttctaata 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct cccaccttttcttctaatga 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct caccttttcttctaatgagt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct accttttcttctaatgagtt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct ccttttcttctaatgagtca 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct cttttcttctaatgagtcga 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct ttttcttctaatgagtcgat 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct tttcttctaatgagtcgact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acccccagtctcccacctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccccagtctcccaccttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccccagtctcccacctttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccagtctcccaccttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagtctcccaccttttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtctcccaccttttctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtctcccaccttttcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctcccaccttttcttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctcccaccttttcttcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccaccttttcttctaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaccttttcttctaatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accttttcttctaatgagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttttcttctaatgagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttttcttctaatgagtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttcttctaatgagtcga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcttctaatgagtcgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcttctaatgagtcgact 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcacccccagtctcccacctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cacccccagtctcccaccttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct acccccagtctcccacctttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cccccagtctcccaccttttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccccagtctcccaccttttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cccagtctcccaccttttctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccagtctcccaccttttcttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagtctcccaccttttcttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agtctcccaccttttcttcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctcccaccttttcttctaata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcccaccttttcttctaatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccaccttttcttctaatgagt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccttttcttctaatgagtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct accttttcttctaatgagtca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccttttcttctaatgagtcga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttttcttctaatgagtcgat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttttcttctaatgagtcgact 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct gtttctccttggtctaagta 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct cctgtggtcctcccacgctt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct acatacaccccttccacctt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct ggtgtacatacaccccttct 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct gtggagggtctcactttcca 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct tacgtccacttccaagggaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct cagtctcccaccttttctct 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct tgtggtcctcccacgctctt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aaaaatgctgttcagcacctccc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct ttagaagaaaaggtgggagcct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcattagaagaaaaggtgtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct ttcattagaagaaaaggtggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct taagctgttgggtagactctgt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct attgctggaaagtgagaccctc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct aaaaatgctgttcagcacctcc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct aaaaatgctgttcagcaccttt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct taaaatgctgttcagcaccttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aaaaatgctgttcagcacctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaaatgctgttcagcacctt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct attgctggaaagtgagaccctt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct taagctgttgggtagactcttt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct ttagaagaaaaggtgggagatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct tttagaagaaaaggtgggagtt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct attgctggaaagtgagaccctcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct attgctggaaagtgagaccct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aaaaatgctgttcagcacctc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct taagctgttgggtagactctgtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taagctgttgggtagactctg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct taaaatgctgttcagcacctcc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taaaatgctgttcagcacctc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct ttagaagaaaaggtgggagact 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct tttagaagaaaaggtgggagac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttagaagaaaaggtgggagtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct ttcattagaagaaaaggtgggg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct atcattagaagaaaaggtggtt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct taaaatgctgttcagcacctccc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgtgggctctctctcatccgctt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ctgtgggctctctctcatccgct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct agactctgtgggctctctctcgg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct attgggtagactctgtgggctct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttgtgggctctctctcatccggg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgttgggtagactctgtgggctc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgttgggtagactctgtgggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttgggtagactctgtgg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttgttgggtagactctgtgggct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgttgggtagactctgtggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgttgggtagactctgtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tttagaagaaaaggtgggatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct aaggtgggagactgggggtgac 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct aaaggtgggagactgggggtga 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct aaaaggtgggagactgggggtg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct aaaaaggtgggagactgggggt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct agaaaaggtgggagactggggg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct aagaaaaggtgggagactgggg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct aaagaaaaggtgggagactggg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct agaagaaaaggtgggagactgg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct tagaagaaaaggtgggagactg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct tattagaagaaaaggtgggaga 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct tcattagaagaaaaggtgggag 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct actcattagaagaaaaggtggg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct aactcattagaagaaaaggtgg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct tgactcattagaagaaaaggtg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct tcgactcattagaagaaaaggt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct atcgactcattagaagaaaagg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct agtcgactcattagaagaaaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aaggtgggagactgggggtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aaaggtgggagactgggggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aaaaggtgggagactgggggt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aaaaaggtgggagactggggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agaaaaggtgggagactgggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aagaaaaggtgggagactggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aaagaaaaggtgggagactgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agaagaaaaggtgggagactg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagaagaaaaggtgggagact 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tattagaagaaaaggtgggag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcattagaagaaaaggtggga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct actcattagaagaaaaggtgg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aactcattagaagaaaaggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgactcattagaagaaaaggt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgactcattagaagaaaagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atcgactcattagaagaaaag 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agtcgactcattagaagaaaa 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aaggtgggagactgggggtgaca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aaaggtgggagactgggggtgac 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aaaaggtgggagactgggggtga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aaaaaggtgggagactgggggtg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct agaaaaggtgggagactgggggt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aagaaaaggtgggagactggggg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aaagaaaaggtgggagactgggg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct agaagaaaaggtgggagactggg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tagaagaaaaggtgggagactgg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tattagaagaaaaggtgggagac 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tcattagaagaaaaggtgggaga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct actcattagaagaaaaggtggga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aactcattagaagaaaaggtggg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgactcattagaagaaaaggtgg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tcgactcattagaagaaaaggtg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct atcgactcattagaagaaaaggt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct agtcgactcattagaagaaaagg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct tacttagaccaaggagaaactt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct aagcgtgggaggaccacaggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct aaggtggaaggggtgtatgttt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct agaaggggtgtatgtacacctt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct tggaaagtgagaccctccactt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct ttcccttggaagtggacgtatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct aaagaaaaggtgggagactgtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct aagagcgtgggaggaccacatt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct misc_feature 12 note T aaaaatgctgttcagcacctccc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct misc_feature 1 note I, as defined in the specification nttgctggaaagtgagaccctcc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct misc_feature 6 note T misc_feature 1 note I, as defined in the specification nttgctggaaagtgagaccctcc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 1 note I, as defined in the specification nttgctggaaagtgagaccctcc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct misc_feature 1 note I, as defined in the specification naaaatgctgttcagcacctccc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct misc_feature 6 note T misc_feature 1 note I, as defined in the specification naaaatgctgttcagcacctccc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 22 note I, as defined in the specification ttcattagaagaaaaggtggtn 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct gcaccttttcttctaatgaa 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 22 note I, as defined in the specification ttcattagaagaaaaggtgctn 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 17 note I, as defined in the specification ttcattagaagaaaagntggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 20 note I, as defined in the specification ttcattagaagaaaaggtgntt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 21 note T aaaaatgctgttcagcaccttt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 12 note T aaaaatgctgttcagcaccttt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 21 note T taaaatgctgttcagcaccttt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 12 note T taaaatgctgttcagcaccttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 20 note T aaaaatgctgttcagcacctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 12 note T aaaaatgctgttcagcacctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 20 note T taaaatgctgttcagcacctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 12 note T taaaatgctgttcagcacctt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 21 note T attgctggaaagtgagaccctt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct misc_feature 6 note T gggtctcactttccagcaat 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 2 note T attgctggaaagtgagaccctt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 21 note T taagctgttgggtagactcttt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct misc_feature 1 note T tctcccaccttttcttctaa 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 21 note T ttagaagaaaaggtgggagatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 2 note T ttagaagaaaaggtgggagatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 21 note T tttagaagaaaaggtgggagtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 2 note T tttagaagaaaaggtgggagtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 21 note T ttcattagaagaaaaggtggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T ttcattagaagaaaaggtggtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 20 note T ttcattagaagaaaaggtgtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 2 note T ttcattagaagaaaaggtgtt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct misc_feature 22 note T taagctgttgggtagactctgtg 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct misc_feature 6 note T ccaccttttcttctaatgaa 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct misc_feature 6 note T attgctggaaagtgagaccctcc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 6 note T ttcattagaagaaaaggtggtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 6 note T ttcattagaagaaaaggtgtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 5 note T ttcattagaagaaaaggtggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 5 note I, as defined in the specification ttagnagaaaaggtgggagatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 5 note I, as defined in the specification tttanaagaaaaggtgggagtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 5 note I, as defined in the specification ttcantagaagaaaaggtggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 6 note I, as defined in the specification ttagangaaaaggtgggagatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 6 note I, as defined in the specification tttagnagaaaaggtgggagtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 6 note I, as defined in the specification ttcatnagaagaaaaggtggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 7 note I, as defined in the specification ttagaanaaaaggtgggagatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 7 note I, as defined in the specification tttagangaaaaggtgggagtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 7 note I, as defined in the specification ttcattngaagaaaaggtggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 8 note I, as defined in the specification ttagaagnaaaggtgggagatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 8 note I, as defined in the specification tttagaanaaaaggtgggagtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 8 note I, as defined in the specification ttcattanaagaaaaggtggtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcatccacaatgagagtaca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct misc_feature 5 note I, as defined in the specification tgtantctcattgtggatgacga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct misc_feature 6 note I, as defined in the specification tgtacnctcattgtggatgacga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct misc_feature 7 note I, as defined in the specification tgtactntcattgtggatgacga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct misc_feature 8 note I, as defined in the specification tgtactcncattgtggatgacga 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 5 note B, as defined in the specification ttagnagaaaaggtgggagatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 5 note B, as defined in the specification tttanaagaaaaggtgggagtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 5 note B, as defined in the specification ttcantagaagaaaaggtggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 6 note B, as defined in the specification ttagangaaaaggtgggagatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 6 note B, as defined in the specification tttagnagaaaaggtgggagtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 6 note B, as defined in the specification ttcatnagaagaaaaggtggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_structure 7 note B, as defined in the specification ttagaanaaaaggtgggagatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 7 note B, as defined in the specification tttagangaaaaggtgggagtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 7 note B, as defined in the specification ttcattngaagaaaaggtggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 8 note B, as defined in the specification ttagaagnaaaggtgggagatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 8 note B, as defined in the specification tttagaanaaaaggtgggagtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 8 note B, as defined in the specification ttcattanaagaaaaggtggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 5 note X, as defined in the specification ttagnagaaaaggtgggagatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 5 note X, as defined in the specification tttanaagaaaaggtgggagtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 5 note X, as defined in the specification ttcantagaagaaaaggtggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 6 note X, as defined in the specification ttagangaaaaggtgggagatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 6 note X, as defined in the specification tttagnagaaaaggtgggagtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 6 note X, as defined in the specification ttcatnagaagaaaaggtggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 7 note X, as defined in the specification ttagaanaaaaggtgggagatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 7 note X, as defined in the specification tttagangaaaaggtgggagtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 7 note X, as defined in the specification ttcattngaagaaaaggtggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 8 note X, as defined in the specification ttagaagnaaaggtgggagatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 8 note X, as defined in the specification tttagaanaaaaggtgggagtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 8 note X, as defined in the specification ttcattanaagaaaaggtggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct tttaaaagaaaaggtgggagtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct ttcaatagaagaaaaggtggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct ttcataagaagaaaaggtggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct ttagaaaaaaaggtgggagatt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct tttagaaaaaaaggtgggagtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct ttcattaaaagaaaaggtggtt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct misc_feature 2 note T ttgtgggctctctctcatccggg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 22 note I, as defined in the specification ttagaagaaaaggtgggagatn 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 22 note I, as defined in the specification tttagaagaaaaggtgggagtn 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 21 note I, as defined in the specification ttagaagaaaaggtgggagant 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 21 note I, as defined in the specification tttagaagaaaaggtgggagnt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 21 note I, as defined in the specification ttcattagaagaaaaggtggnt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct misc_feature 1 note T tcccaccttttcttctaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 21 note I, as defined in the specification ttagaagaaaaggtgggagtn 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 21 note I, as defined in the specification tttagaagaaaaggtgggatn 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 21 note I, as defined in the specification ttcattagaagaaaaggtgtn 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 20 note I, as defined in the specification ttagaagaaaaggtgggagnt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 20 note I, as defined in the specification tttagaagaaaaggtgggant 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 20 note I, as defined in the specification ttcattagaagaaaaggtgnt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct ttcattagaagaaaaggtggga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttcattagaagaaaaggtggg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 1 note B, as defined in the specification ntcattagaagaaaaggtggga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 1 note B, as defined in the specification ntcattagaagaaaaggtggg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 1 note B, as defined in the specification ntcattagaagaaaaggtggtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 1 note B, as defined in the specification ntcattagaagaaaaggtgtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 21 note I, as defined in the specification misc_feature 1 note B, as defined in the specification ntcattagaagaaaaggtggnt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 20 note I, as defined in the specification misc_feature 1 note B, as defined in the specification ntcattagaagaaaaggtgnt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 22 note I, as defined in the specification misc_feature 1 note B, as defined in the specification ntcattagaagaaaaggtggtn 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 21 note I, as defined in the specification misc_feature 1 note B, as defined in the specification ntcattagaagaaaaggtgtn 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 1 note X, as defined in the specification ntcattagaagaaaaggtggga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 1 note X, as defined in the specification ntcattagaagaaaaggtggg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 1 note X, as defined in the specification ntcattagaagaaaaggtggtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 1 note X, as defined in the specification ntcattagaagaaaaggtgtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 21 note I, as defined in the specification misc_feature 1 note X, as defined in the specification ntcattagaagaaaaggtggnt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 20 note I, as defined in the specification misc_feature 1 note X, as defined in the specification ntcattagaagaaaaggtgnt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 22 note I, as defined in the specification misc_feature 1 note X, as defined in the specification ntcattagaagaaaaggtggtn 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 21 note I, as defined in the specification misc_feature 1 note X, as defined in the specification ntcattagaagaaaaggtgtn 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T ttcattagaagaaaaggtggga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T ttcattagaagaaaaggtggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T ttcattagaagaaaaggtgtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T misc_feature 1 note B, as defined in the specification ntcattagaagaaaaggtggga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T misc_feature 1 note B, as defined in the specification ntcattagaagaaaaggtggg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T misc_feature 1 note B, as defined in the specification ntcattagaagaaaaggtggtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T misc_feature 1 note B, as defined in the specification ntcattagaagaaaaggtgtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T misc_feature 1 note X, as defined in the specification ntcattagaagaaaaggtggga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T misc_feature 1 note X, as defined in the specification ntcattagaagaaaaggtggg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T misc_feature 1 note X, as defined in the specification ntcattagaagaaaaggtggtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T misc_feature 1 note X, as defined in the specification ntcattagaagaaaaggtgtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T misc_feature 21 note I, as defined in the specification ttcattagaagaaaaggtggnt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T misc_feature 20 note I, as defined in the specification ttcattagaagaaaaggtgnt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T misc_feature 21 note I, as defined in the specification misc_feature 1 note B, as defined in the specification ntcattagaagaaaaggtggnt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T misc_feature 20 note I, as defined in the specification misc_feature 1 note B, as defined in the specification ntcattagaagaaaaggtgnt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T misc_feature 21 note I, as defined in the specification misc_feature 1 note X, as defined in the specification ntcattagaagaaaaggtggnt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 2 note T misc_feature 5 note T misc_feature 20 note I, as defined in the specification misc_feature 1 note X, as defined in the specification ntcattagaagaaaaggtgnt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 22 note I, as defined in the specification misc_feature 2 note T misc_feature 5 note T ttcattagaagaaaaggtggtn 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 21 note I, as defined in the specification misc_feature 2 note T misc_feature 5 note T ttcattagaagaaaaggtgtn 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 22 note I, as defined in the specification misc_feature 1 note B, as defined in the specification misc_feature 2 note T misc_feature 5 note T ntcattagaagaaaaggtggtn 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 21 note I, as defined in the specification misc_feature 1 note B, as defined in the specification misc_feature 2 note T misc_feature 5 note T ntcattagaagaaaaggtgtn 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 22 note I, as defined in the specification misc_feature 1 note X, as defined in the specification misc_feature 2 note T misc_feature 5 note T ntcattagaagaaaaggtggtn 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 21 note I, as defined in the specification misc_feature 1 note X, as defined in the specification misc_feature 2 note T misc_feature 5 note T ntcattagaagaaaaggtgtn 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct ttcattagaagaaaaggtgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcattagaagaaaaggtg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cccaccttttcttctaatgaa 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttcattagaagaaaaggtgggtt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct misc_feature 22 note T misc_feature 23 note T ttcattagaagaaaaggtgggtt 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct misc_feature 21 note T misc_feature 22 note T ttcattagaagaaaaggtggtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct misc_feature 20 note T misc_feature 21 note T ttcattagaagaaaaggtgtt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttcattagaagaaaaggtgggag 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct misc_feature 6 note T tgtactctcattgtggatgacga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aatttagaccaaggagaaacgtc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgtttctccttggtctaaatt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct cacttagaccaaggagaaacgtc