WO US2024/017167 2024-02-23 STAN-2062WO US 63/448,131 2023-02-24 The Board of Trustees of the Leland Stanford Junior University Hyongsok Tom Soh Methods of Sequencing Polypeptides and Related Compositions 9 7 AA PAT source 1..7 mol_type protein organism synthetic construct WGGGGGK 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct atgctggatgaggtcctggc 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct gtcatgctaggtctcgccaggacctcatccagcat 8 AA PAT source 1..8 mol_type protein organism synthetic construct VARIANT 8 note azidolysine RGFDWGKX 7 AA PAT source 1..7 mol_type protein organism synthetic construct RGFDWGK 4 AA PAT source 1..4 mol_type protein organism synthetic construct MOD_RES 1 note phosphorylation MOD_RES 3 note phosphorylation YWYF 4 AA PAT source 1..4 mol_type protein organism synthetic construct MOD_RES 1 note phosphorylation YWYF 4 AA PAT source 1..4 mol_type protein organism synthetic construct MOD_RES 3 note phosphorylation YWYF 4 AA PAT source 1..4 mol_type protein organism synthetic construct YWYF