WO ADBS-096WO US 63/465,790 2023-05-11 Digital Biotechnologies, Inc. Jason H. Bielas NUCLEIC ACID SCAFFOLDS AND RELATED DEVICES AND METHODS 230 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct taaattgttagctgataaattaataaagggtg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ctggctgacgcgaaacaaagtacagggtaaaa 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct agaaaggccggagacagtcaaatcaccat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct atatttaaataaagtaccgacaaattacgagc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gattcatctaacaaagctgctcattcttgaca 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tatccggtattctaagtcagatatagaaggct 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gcttttgcgcggagtgagaatagagacgttag 41 DNA PAT source 1..41 mol_type other DNA organism synthetic construct gggagctaaacagatcaaaatcaccagtgccttgagtagga 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ctgtcgtgaaaacgacggccagtgatgtgctg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct agtccactttcaccagtgagacggaattgcgt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct cattttcagtacaaactacaacgctccaaaag 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct attcatcaacagtaccttttacatatttcaat 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct aggtctttaccctgactat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct agaaccggactcatctttgacccccaacctaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tatagtcaaacgagaatgaccatagagggggt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tacgtaatacaatgacaacaaccatctccaaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct atttttgttaaatcagttaaaattcgcattaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ggtgccgtacgagcacgtataacgccagaatc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct taaatgaaataggtgtatcaccgtaaggatta 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct attaatgaatcgggtaccgtaacacagctt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct aactaacggccctgacgagaaacacgcatagg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tatctaaaactcgtattaaatcctttggatta 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct gctttttttcccagtcacgacgttgtccagctgc 22 DNA PAT source 1..22 mol_type other DNA organism synthetic construct ggtgccggaaatatccgctcac 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct aagggttatacaaacaattcgacaatatcttt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct cgcctgcacagagatagaaccctttgcaacag 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct cctggccctggggtgcctaatgagagctcgaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gagcttgagcccgagatagggttgcttcaccg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tctttccaaaggaacaactaaagggaggcttg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tcgttagaccaaatcaagtttttttccaacgt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct cagttgattcccaattgtttcattccatataa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ggattagctcctcattaaagccagcaccacca 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gtctggaactgcgaacgagtagattgaaaagg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gaaaaacgtgtttttataatcagttactatgg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct cccgacttaggaatcattaccgcgtcaacaat 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct aaatcgcgtaaatcgtcgctattaattaagcatt 42 DNA PAT source 1..42 mol_type other DNA organism synthetic construct attacgcagtatgttagcaaaaccattaccattagcaaggcc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct aataacataaactggcatgattaagactcctt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tcaccgtcagcgtcagactgtagccagaaccg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct acgttattcagttgaaaggaattgattaacac 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct actggtaaaacagttaatgcccccaccaccct 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tttatcaaaatcatagaagagtcaatagtgaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct cctcagaagaaagtattaagaggctctgaatt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct aattcataaggtaaatattgacggtttcggtc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct atactgcgattcaactaatgcagaggtagaaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tagccagcgaaaagccccaaaaacatttttga 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct aatacatttgaggattagagccgtcaatagat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tagctgttcataaagtgtaaagcctgagagag 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gatgatactcagagccgccaccctgcgttttc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tgcgctcagcaggtcgactctagatcttcgct 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct aagagtaatcagtgaataaggcttgaacaaca 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct tcatataacctgtttagctatatttttaatactt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tgaccctgcatttggggcgcgagcttagtttg 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct ttgcgggagaagcaggaataccacgaatcg 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct aattgctgaatataagacttcaaaaggtca 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tgaaacatccgccaccctcagaacacagccct 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct ggattagagagtacctttaattgctctagagctt 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct ggtaacgccagggcgaggtgaattaggcaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct agtaacaaatgtcaatcatatgtaattgcctg 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct aagaaacaaacggcggattgaccgtattaagttg 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct ctaacgaataagagcaactgaacctcaaat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tacctgagtcaatatatgtgagtgagattaag 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct acgctgaggtctgagagactacctttttaacc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct atgtagaaaagtaccgcactcatcgttgctat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct acgctggtacatacgagccggaagtcctgtgt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ttgcagcaataaatcaaaagaatacggggaaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gggagcccgccgctacagggcgcggaggccac 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct atattttgctcattttttaaccaactcaggaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct acgcgagaaaacttttaatcgcaagacaaaga 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct caaataaaggggttttgctcagtaataagtat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct atttttgcggatggctcttttgataagaggtc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tttttcttattaaagaacgtggacggggtcga 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct cataattttaggcagagttttcccttagaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ctgaacaaaaataagaaacgatttgcgaacct 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct atcattttctcaatcaatatctggagccagca 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gagcctttaccgatagttgcgccggccactac 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct agcccggattttctgtatgggattttgct 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct gcgcagacggtcaatcataagggaacctgctccat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ccagtagccgtagaaaatacatacggaatacc 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct attcaaatcttttcatagaggccgattaaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct caaatcaaaattttaaaagtttgatgatggca 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tatcagagaaaataaacagccataccttaaat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct aaaaaggcctgtagcattccacagcgccaccc 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct atcaaaccgcggaacaaagaaaccaccagcaacg 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct tccttgaaaggttgggttatataactataggaat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tacttctgtttcaggtttaacgtcaacaaaca 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ataataatgcgtaacgatctaaagaccgccac 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct atcggcataaattattcattaaagtttatttt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tcaagaaaaattaccttttttaatggaaacag 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct gcaaatcctcaaatatattttagttaatttcatc 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct ggaaacgtcaccaatgaaaccgccagcattgacaggattcacaaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ttaacaatttcatttgacaaaattaattacat 42 DNA PAT source 1..42 mol_type other DNA organism synthetic construct ctgtttgatggtggttccgaaagggaagaaagcgaaaggagc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gccggcgacgcgtaaccaccacacgcaaatta 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gtatcggctaggaacgccatcaaacaaatatt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gaaagacagcatcggaacgaggccggaacgag 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct cgagtaaatattaccgccagccatctgacctg 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct gggattttcgtctgaaatggattatttacgcgac 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct atgggcgcagctggcgaaagggggccaagctt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct atacagtaatataatcctgattgtttgcccga 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ctggccaaacagtgccacgctgagtcagttgg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct acatccaaaattaagcaataaagctgtaggta 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tacataaacaaaagaagatgatgaagatgaat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ttgcctttaccgacttgagccattataaaaga 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct agagccagtaatcagtagcgacaggagccgcc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct caaagggctttgcgtattgggcgccgggaaac 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct actccaactatcgcgttttaattccatcaaaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ggcaaagaattagcaataaatcatacaggcaa 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct caatatgatattcaaccgttcaaacgtta 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ccaccctccagtaagcgtcatacatattattc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gtcacaataagaaaagtaagcagaagcgctaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ccgcgaccgaactgaccaactttgtttaattt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct caaagttagacaccacggaataaggtgaatta 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct catagttatttttcacgttgaaaatcgcccac 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct cgaaccagaccggaagcaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct cccaatccagtcagagggtaattgtagccgaa 31 DNA PAT source 1..31 mol_type other DNA organism synthetic construct gttgggaattgggcttgagatggaaagagga 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tggcatcaaaatcggttgtaccaatcatatat 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct tttgcacgtaaaacagaaataaagaaattgcgtagataataatgg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ttctttgatgtagcggtcacgctgacgtggcg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tagccctaaaacatcgccattaaaaatgctat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ttcatgaggatatattcggtcgctaattgcga 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct acatgtaatactagaaaaagcctgataaggcg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct agagtctgaaaatttttagaacccaaacatta 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gtctatcactacgtgaaccatcacatcagagc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tttaaatgcaaaggctatcaggtcccccggtt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tttgcaccctaatttgccagttacagataacc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct attttatcgaacgggtattaaaccaccaatca 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct caacgctcaactccagacg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ctgagaagctcatggaaatacctagggacatt 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct acttgaacctaccatatcaaaatta 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct aagcccaataacagtgcccgtatataagtttt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ataatcggccagtaataagagaatcaacgcca 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ttcatcgtgcgggaggttttgaagttatttat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct taccgttcagagccaccaccctcaaatcaagt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct aattccacacattgccccagcaggcgaaaatc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tggcacaggtaatatccagaacaaagagtctg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gagatctacaatgcctgagtaatgctcagagc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct agaaaggaatcggcaaaatcccttagcggtcc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct acgacaatcctgaacaagaaaaattttttatt 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct ttcgagctgtctttcctataccaagttaca 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct cgcaaatggtcaaaatattcattgaggaag 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct cgtcgagagggttgatccaggcggataagtgcacgattgg 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct cccgaaatgctgtagctcaacatgttatacattt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gttacttaggtagcaacggctacataaaggcc 24 DNA PAT source 1..24 mol_type other DNA organism synthetic construct ccttgataggttgaggcaggtcag 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct accgttgtactatcggccttgctgacaatatt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tccatcacccgccgcgcttaatgcccgattta 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ctcaagagactcaggaggtttagtttttgtcg 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct caactttaactggctcattataccagacgacgata 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct aatagatttagaagtattag 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gggcgctagggcgctggcaagttagtaataac 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct ccgtgtgataatttagtatcatatgcggaatcgcc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gactggattttaaacagttcagaagaagcaaa 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct gcggattggagcttcaaag 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct accagaacaatggaaagcgcagtctgagactc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct acgtcaaaagacgggagaattaacgaaacgca 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct acccatccaacgcgcggggagaggcgggaaaaacc 42 DNA PAT source 1..42 mol_type other DNA organism synthetic construct aaacaactttcaacagtttcagggatcgtcaccctcagcagc 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct aaaaccaaaatagcgagag 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gcataaccgaagtttccattaaacacggagat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct caagattagagaacaagcaagccgaatatccc 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct gcttttgcataaccctcgtttaccagtcaggac 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tgtataagaataattcgcgtctggtgccagtt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct cagcgccaatagcaatagctatctttgagtta 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tttgaatgaccgaacgaaccaccataacaact 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct aggagcacgcagaagataaaacagagaatacg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct attacgccatcgtaaccgtgcatcccttcctg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct cagggagtgaggctttgaggactagtcgaaat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct aatagtaagaattacgaggcatagataaaacg 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct attacaacggtaatcgtaaaactagccccgtcgg 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct attctccgtgggatacactaaaacatattc 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct ttccaactgaatcttacaaggagcggaatt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct aaagcgtaaggtgaggcggtcagtaggaaggt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct cgctcaatagacaggaacggtacgtgctttcc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct aacggggtcggaaccagagccacccttattag 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tgattgccagtgttgttccagtttaccctaaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct cgtttgccccgattgagggagggatggtttac 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct ttctgagaataaacacctgtaaatgctgat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct atagccccaccggaaccgcctcccaggagtgt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct accattagttaaatatgcaactaaagtacggt 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct gcgcctgtttacccaatag 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct tagtctttaatgagtagaagaactcaaagcaatac 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct agataagtaaacaacatgttcagctaatgcagaac 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct atcatcatggattcgcctgattgctttgatatca 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gggtaccgtgagctaactcacattgcaacagc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ttatgcgattttaagaatcattgtgaattacc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gcaaatgaacgaccagtaataaaacattttga 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct caagcaaaaacgcgaggcgttttatttgttta 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct ttaaataacctaaatttaatggtttgaaataccga 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gaaggcaccagcgattataccaagccttcatc 22 DNA PAT source 1..22 mol_type other DNA organism synthetic construct atcacttgcctgcgcgaactga 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tgaggggagcgatcggtgcgggccggatcccc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct aagattcagccggagagggtagctaggaagat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct aacgcaaaccagaaggaaaccgagtgaacacc 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct ccagtcacaaaatctaaagcatcaccttggaaac 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct cacaagaataccgaagccctttttcaatagaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tcagagcctgcctatttcggaacctggctttt 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct ttaattgattatacaaattcttaccagtataaagc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct agattaagaatccccctcaaatgcagcgtcca 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gcatgcctctgcccgctttccagtcagggtgg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct aacgaaagtcttaaacagcttgataattgtat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct cggtttatctgagtttcgtcaccagggatagc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gagccgccatcgatagcagcaccgcaaaatca 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct acactatcaaaagaagttttgccaaatcaaaaatc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ataaagctattctactaatagtagtagcatta 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct tagcagcctttacagagag 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct caaaagaaaacagggaagcgcattaatgaaaa 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct gatttctttatttcaacgcaaggatagagcaaac 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tccggcttaacatagcgatagcttaataacct 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gaaattgtccaggcaaagcgccattccagcca 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct cagatgaatcgcctgataaattgtaagacttt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ttattacatacataacgccaaaagaatgttta 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ttcgtaatgcaactgttgggaaggcgacgaca 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct gctttccggcaccgcttct 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gatcgcactcgccattcaggctgccatggtca 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct aatgaaaagacaaaaggattggcagattca 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct aagagaatcgatgccaaatcaacgagttga 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct gataatcatttcatcaacattaaatggtgtag 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct agtagtaaagaaaaatctacgttataagagca 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct acaataacattcctgattatcagagtaacatt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct agcccaatagcgtctttccagagccagctaca 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct caaggcgaatgggataggtcacgttgtgagcg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct tgcttctgcagaggcgaattattccgggagaa 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ttgctttgaaagcactaaatcggaggaacaag 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ataataacataaaggtggcaacattgggaatt 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct ttgtatcacggtgtacagaccaggccagaacg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct atcctaataggtaaagtaattctgagtagggc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct agactagactagactagact 15 DNA PAT source 1..15 mol_type other DNA organism synthetic construct ccccccccccccccc