WO 54462-736.601 US 63/286,393 2021-06-11 EMPIRICO INC. TREATMENT OF FGG RELATED DISEASES AND DISORDERS 3786 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaaggaggagcttcaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaggaggagcttcaacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaggaggagcttcaacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggaggagcttcaacctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggaggagcttcaacctgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaggagcttcaacctgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaggagcttcaacctgtgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggagcttcaacctgtgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagcttcaacctgtgtgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagcttcaacctgtgtgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcttcaacctgtgtgcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcttcaacctgtgtgcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttcaacctgtgtgcaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaacctgtgtgcaaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaacctgtgtgcaaaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caacctgtgtgcaaaatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacctgtgtgcaaaatctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acctgtgtgcaaaatctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctgtgtgcaaaatctggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtgtgcaaaatctggga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgtgcaaaatctgggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgtgcaaaatctgggaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgcaaaatctgggaacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgcaaaatctgggaacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcaaaatctgggaacctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaaaatctgggaacctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaaatctgggaacctgac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaatctgggaacctgaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatctgggaacctgacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatctgggaacctgacagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctgggaacctgacagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgggaacctgacagtat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgggaacctgacagtata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggaacctgacagtatag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggaacctgacagtatagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaacctgacagtataggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaacctgacagtataggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacctgacagtataggttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acctgacagtataggttgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctgacagtataggttggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgacagtataggttgggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacagtataggttggggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacagtataggttgggggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagtataggttgggggcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtataggttgggggcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtataggttgggggccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtataggttgggggccagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tataggttgggggccagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataggttgggggccaggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taggttgggggccaggatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggttgggggccaggatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggttgggggccaggatgag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttgggggccaggatgagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgggggccaggatgagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggggccaggatgaggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggggccaggatgaggaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggggccaggatgaggaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggccaggatgaggaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggccaggatgaggaaaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccaggatgaggaaaaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaggatgaggaaaaagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggatgaggaaaaaggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggatgaggaaaaaggaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggatgaggaaaaaggaacg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaggaaaaaggaacgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgaggaaaaaggaacggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaggaaaaaggaacggga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaggaaaaaggaacgggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggaaaaaggaacgggaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaaaaaggaacgggaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaaaaggaacgggaaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaaggaacgggaaagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaggaacgggaaagacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaggaacgggaaagacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggaacgggaaagacctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggaacgggaaagacctgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaacgggaaagacctgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaacgggaaagacctgccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacgggaaagacctgccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acgggaaagacctgcccac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgggaaagacctgcccacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggaaagacctgcccaccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaaagacctgcccaccct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaagacctgcccaccctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagacctgcccacccttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagacctgcccacccttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agacctgcccacccttctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacctgcccacccttctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acctgcccacccttctggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctgcccacccttctggta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgcccacccttctggtaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcccacccttctggtaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcccacccttctggtaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccacccttctggtaagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccacccttctggtaaggag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacccttctggtaaggagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acccttctggtaaggaggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccttctggtaaggaggcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttctggtaaggaggccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttctggtaaggaggcccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctggtaaggaggccccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctggtaaggaggccccgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggtaaggaggccccgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggtaaggaggccccgtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtaaggaggccccgtgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaaggaggccccgtgatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaggaggccccgtgatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggaggccccgtgatcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggaggccccgtgatcagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaggccccgtgatcagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaggccccgtgatcagctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggccccgtgatcagctcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggccccgtgatcagctcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccccgtgatcagctccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccccgtgatcagctccagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccgtgatcagctccagcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgtgatcagctccagcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgtgatcagctccagccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgatcagctccagccatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatcagctccagccattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatcagctccagccatttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcagctccagccatttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagctccagccatttgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagctccagccatttgcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agctccagccatttgcagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctccagccatttgcagtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctccagccatttgcagtcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccagccatttgcagtcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagccatttgcagtcctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagccatttgcagtcctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agccatttgcagtcctggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccatttgcagtcctggct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccatttgcagtcctggcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catttgcagtcctggctat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttgcagtcctggctatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgcagtcctggctatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgcagtcctggctatccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcagtcctggctatccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcagtcctggctatcccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtcctggctatcccagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtcctggctatcccagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcctggctatcccaggag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctggctatcccaggagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctggctatcccaggagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggctatcccaggagctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggctatcccaggagctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggctatcccaggagcttac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctatcccaggagcttaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctatcccaggagcttacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcccaggagcttacata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcccaggagcttacataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcccaggagcttacataaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccaggagcttacataaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaggagcttacataaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggagcttacataaaggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggagcttacataaaggga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagcttacataaagggac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagcttacataaagggaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcttacataaagggacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcttacataaagggacaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttacataaagggacaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttacataaagggacaattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacataaagggacaattgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acataaagggacaattgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cataaagggacaattggag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataaagggacaattggagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaagggacaattggagcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagggacaattggagcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagggacaattggagcctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agggacaattggagcctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggacaattggagcctgag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggacaattggagcctgaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacaattggagcctgagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaattggagcctgagagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caattggagcctgagaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattggagcctgagaggtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attggagcctgagaggtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggagcctgagaggtgac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggagcctgagaggtgaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagcctgagaggtgacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagcctgagaggtgacagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcctgagaggtgacagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcctgagaggtgacagtgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctgagaggtgacagtgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgagaggtgacagtgctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgagaggtgacagtgctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagaggtgacagtgctgac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaggtgacagtgctgaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaggtgacagtgctgacac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggtgacagtgctgacact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtgacagtgctgacacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgacagtgctgacactac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacagtgctgacactaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacagtgctgacactacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagtgctgacactacaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtgctgacactacaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtgctgacactacaaggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgctgacactacaaggct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgctgacactacaaggctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgacactacaaggctcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgacactacaaggctcgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacactacaaggctcgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacactacaaggctcggag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acactacaaggctcggagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cactacaaggctcggagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actacaaggctcggagctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctacaaggctcggagctcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacaaggctcggagctccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaaggctcggagctccgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaggctcggagctccggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggctcggagctccgggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggctcggagctccgggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggctcggagctccgggcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctcggagctccgggcact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcggagctccgggcactc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcggagctccgggcactca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cggagctccgggcactcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagctccgggcactcaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagctccgggcactcagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agctccgggcactcagaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctccgggcactcagacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctccgggcactcagacatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccgggcactcagacatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgggcactcagacatcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgggcactcagacatcatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggcactcagacatcatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcactcagacatcatgag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcactcagacatcatgagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cactcagacatcatgagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actcagacatcatgagttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcagacatcatgagttgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagacatcatgagttggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagacatcatgagttggtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agacatcatgagttggtcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacatcatgagttggtcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acatcatgagttggtcctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcatgagttggtccttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcatgagttggtccttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatgagttggtccttgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catgagttggtccttgcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgagttggtccttgcacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgagttggtccttgcaccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagttggtccttgcacccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttggtccttgcaccccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttggtccttgcacccccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggtccttgcacccccgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggtccttgcacccccgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtccttgcacccccggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtccttgcacccccggaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccttgcacccccggaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttgcacccccggaattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgcacccccggaattta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgcacccccggaatttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcacccccggaatttaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcacccccggaatttaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacccccggaatttaattc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acccccggaatttaattct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccccggaatttaattctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccccggaatttaattctct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccggaatttaattctcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccggaatttaattctctac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cggaatttaattctctact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaatttaattctctactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaatttaattctctacttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatttaattctctacttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttaattctctacttcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttaattctctacttctat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaattctctacttctatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taattctctacttctatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattctctacttctatgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attctctacttctatgctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctctacttctatgctct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctctacttctatgctctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctctacttctatgctcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctacttctatgctctttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctacttctatgctctttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacttctatgctcttttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttctatgctcttttatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttctatgctcttttattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctatgctcttttatttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctatgctcttttatttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctatgctcttttatttctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgctcttttatttctct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgctcttttatttctctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgctcttttatttctctct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctcttttatttctctctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcttttatttctctcttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttttatttctctcttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttttatttctctcttcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttatttctctcttcaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttatttctctcttcaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatttctctcttcaacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatttctctcttcaacatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttctctcttcaacatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttctctcttcaacatgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctctcttcaacatgtgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctctcttcaacatgtgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctctcttcaacatgtgtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctcttcaacatgtgtagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcttcaacatgtgtagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttcaacatgtgtagcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttcaacatgtgtagcata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaacatgtgtagcatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaacatgtgtagcatatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caacatgtgtagcatatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacatgtgtagcatatgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acatgtgtagcatatgttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catgtgtagcatatgttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgtgtagcatatgttgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgtagcatatgttgcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgtagcatatgttgctac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtagcatatgttgctacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtagcatatgttgctacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagcatatgttgctaccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcatatgttgctaccaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcatatgttgctaccagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catatgttgctaccagaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatgttgctaccagagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgttgctaccagagaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgttgctaccagagacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttgctaccagagacaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttgctaccagagacaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgctaccagagacaactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgctaccagagacaactgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctaccagagacaactgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctaccagagacaactgctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taccagagacaactgctgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accagagacaactgctgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagagacaactgctgcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagagacaactgctgcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agagacaactgctgcatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagacaactgctgcatctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agacaactgctgcatctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacaactgctgcatcttag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaactgctgcatcttaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caactgctgcatcttagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aactgctgcatcttagatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgctgcatcttagatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgctgcatcttagatgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgctgcatcttagatgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgcatcttagatgaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgcatcttagatgaaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcatcttagatgaaagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcatcttagatgaaagatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcttagatgaaagattc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcttagatgaaagattcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttagatgaaagattcgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttagatgaaagattcggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttagatgaaagattcggta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagatgaaagattcggtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agatgaaagattcggtagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgaaagattcggtagtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaaagattcggtagttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaagattcggtagttatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagattcggtagttattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagattcggtagttattgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agattcggtagttattgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gattcggtagttattgtcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attcggtagttattgtcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcggtagttattgtccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcggtagttattgtccaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cggtagttattgtccaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtagttattgtccaacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtagttattgtccaactac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagttattgtccaactacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttattgtccaactacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttattgtccaactacctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttattgtccaactacctgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tattgtccaactacctgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attgtccaactacctgtgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtccaactacctgtggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtccaactacctgtggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtccaactacctgtggcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccaactacctgtggcatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaactacctgtggcattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caactacctgtggcattgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aactacctgtggcattgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actacctgtggcattgcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctacctgtggcattgcaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacctgtggcattgcagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acctgtggcattgcagatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctgtggcattgcagattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtggcattgcagatttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtggcattgcagatttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtggcattgcagatttcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggcattgcagatttcctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcattgcagatttcctgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcattgcagatttcctgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cattgcagatttcctgtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attgcagatttcctgtcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgcagatttcctgtctac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcagatttcctgtctact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcagatttcctgtctactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagatttcctgtctactta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agatttcctgtctacttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatttcctgtctacttatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttcctgtctacttatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcctgtctacttatcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcctgtctacttatcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctgtctacttatcaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctgtctacttatcaaacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtctacttatcaaacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtctacttatcaaaccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctacttatcaaaccaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctacttatcaaaccaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctacttatcaaaccaaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacttatcaaaccaaagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttatcaaaccaaagtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttatcaaaccaaagtaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatcaaaccaaagtagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcaaaccaaagtagaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcaaaccaaagtagacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaaccaaagtagacaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaaccaaagtagacaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaccaaagtagacaagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaccaaagtagacaaggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accaaagtagacaaggatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaaagtagacaaggatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaagtagacaaggatcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagtagacaaggatctac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtagacaaggatctaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtagacaaggatctacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtagacaaggatctacagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagacaaggatctacagtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agacaaggatctacagtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacaaggatctacagtctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaaggatctacagtcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaggatctacagtctttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggatctacagtctttgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggatctacagtctttgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggatctacagtctttggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatctacagtctttggaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctacagtctttggaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctacagtctttggaagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctacagtctttggaagaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacagtctttggaagacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagtctttggaagacatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtctttggaagacatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtctttggaagacatctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctttggaagacatctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctttggaagacatcttac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttggaagacatcttaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttggaagacatcttacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggaagacatcttacatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggaagacatcttacatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaagacatcttacatcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagacatcttacatcaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagacatcttacatcaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agacatcttacatcaagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacatcttacatcaagttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acatcttacatcaagttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcttacatcaagttgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcttacatcaagttgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttacatcaagttgaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttacatcaagttgaaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttacatcaagttgaaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacatcaagttgaaaacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acatcaagttgaaaacaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcaagttgaaaacaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcaagttgaaaacaaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaagttgaaaacaaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caagttgaaaacaaaacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagttgaaaacaaaacatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttgaaaacaaaacatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttgaaaacaaaacatcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaaaacaaaacatcaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaaaacaaaacatcagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaaacaaaacatcagaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaacaaaacatcagaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaacaaaacatcagaagtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacaaaacatcagaagtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaaaacatcagaagtcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaaacatcagaagtcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaacatcagaagtcaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaacatcagaagtcaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacatcagaagtcaaacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acatcagaagtcaaacagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcagaagtcaaacagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcagaagtcaaacagctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagaagtcaaacagctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagaagtcaaacagctgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaagtcaaacagctgata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagtcaaacagctgataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtcaaacagctgataaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtcaaacagctgataaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcaaacagctgataaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaacagctgataaaagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaacagctgataaaagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaacagctgataaaagcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacagctgataaaagcaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagctgataaaagcaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagctgataaaagcaatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agctgataaaagcaatcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgataaaagcaatccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgataaaagcaatccaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgataaaagcaatccaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gataaaagcaatccaactc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataaaagcaatccaactca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaaagcaatccaactcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaagcaatccaactcact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagcaatccaactcactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagcaatccaactcactta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcaatccaactcacttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaatccaactcacttata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caatccaactcacttataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatccaactcacttataat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atccaactcacttataatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccaactcacttataatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaactcacttataatcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caactcacttataatcctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aactcacttataatcctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actcacttataatcctgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcacttataatcctgatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcacttataatcctgatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacttataatcctgatgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttataatcctgatgaat 19 AA PAT source 1..19 mol_type protein organism synthetic construct CTTATAATCCTGATGAATC 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttataatcctgatgaatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tataatcctgatgaatcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataatcctgatgaatcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatcctgatgaatcatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatcctgatgaatcatcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcctgatgaatcatcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctgatgaatcatcaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctgatgaatcatcaaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgatgaatcatcaaaacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgaatcatcaaaacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaatcatcaaaaccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgaatcatcaaaaccaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaatcatcaaaaccaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaatcatcaaaaccaaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatcatcaaaaccaaatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcatcaaaaccaaatatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatcaaaaccaaatatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcaaaaccaaatatgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcaaaaccaaatatgata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaaaccaaatatgatag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaaaccaaatatgataga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaccaaatatgatagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaccaaatatgatagacg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaccaaatatgatagacgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accaaatatgatagacgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaaatatgatagacgctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaatatgatagacgctgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatatgatagacgctgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatatgatagacgctgcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatgatagacgctgctac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgatagacgctgctact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgatagacgctgctactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatagacgctgctacttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatagacgctgctactttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atagacgctgctactttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagacgctgctactttgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agacgctgctactttgaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacgctgctactttgaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acgctgctactttgaagtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgctgctactttgaagtcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgctactttgaagtcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgctactttgaagtccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgctactttgaagtccagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctactttgaagtccagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctactttgaagtccaggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactttgaagtccaggaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actttgaagtccaggaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttgaagtccaggaaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgaagtccaggaaaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaagtccaggaaaatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaagtccaggaaaatgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagtccaggaaaatgtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtccaggaaaatgttag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtccaggaaaatgttaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtccaggaaaatgttagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccaggaaaatgttagaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaggaaaatgttagaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggaaaatgttagaagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggaaaatgttagaagaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaaaatgttagaagaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaaatgttagaagaaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaatgttagaagaaatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatgttagaagaaattat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatgttagaagaaattatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgttagaagaaattatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttagaagaaattatgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttagaagaaattatgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttagaagaaattatgaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagaagaaattatgaaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaagaaattatgaaatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagaaattatgaaatatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagaaattatgaaatatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaaattatgaaatatgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaattatgaaatatgaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaattatgaaatatgaagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattatgaaatatgaagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attatgaaatatgaagcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatgaaatatgaagcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgaaatatgaagcatcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgaaatatgaagcatcga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaaatatgaagcatcgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaatatgaagcatcgatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatatgaagcatcgattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatatgaagcatcgatttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatgaagcatcgatttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgaagcatcgattttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgaagcatcgattttaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaagcatcgattttaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagcatcgattttaacac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagcatcgattttaacaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcatcgattttaacacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcatcgattttaacacatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcgattttaacacatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcgattttaacacatgac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgattttaacacatgact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgattttaacacatgactc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gattttaacacatgactca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attttaacacatgactcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttaacacatgactcaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttaacacatgactcaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaacacatgactcaagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taacacatgactcaagtat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacacatgactcaagtatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acacatgactcaagtattc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacatgactcaagtattcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acatgactcaagtattcga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catgactcaagtattcgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgactcaagtattcgata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgactcaagtattcgatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gactcaagtattcgatatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actcaagtattcgatattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcaagtattcgatatttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaagtattcgatatttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caagtattcgatatttgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtattcgatatttgcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtattcgatatttgcagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtattcgatatttgcagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tattcgatatttgcaggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attcgatatttgcaggaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcgatatttgcaggaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgatatttgcaggaaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgatatttgcaggaaatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatatttgcaggaaatata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatttgcaggaaatatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatttgcaggaaatatata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttgcaggaaatatataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgcaggaaatatataat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgcaggaaatatataatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcaggaaatatataattc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaggaaatatataattca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggaaatatataattcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggaaatatataattcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaaatatataattcaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaatatataattcaaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatatataattcaaataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatatataattcaaataat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatataattcaaataatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatataattcaaataatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atataattcaaataatcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tataattcaaataatcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataattcaaataatcaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taattcaaataatcaaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattcaaataatcaaaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attcaaataatcaaaagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaaataatcaaaagatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaataatcaaaagattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaataatcaaaagattgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaataatcaaaagattgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aataatcaaaagattgtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataatcaaaagattgttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatcaaaagattgttaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatcaaaagattgttaacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcaaaagattgttaacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaaagattgttaacctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaaagattgttaacctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaagattgttaacctgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagattgttaacctgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagattgttaacctgaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agattgttaacctgaaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gattgttaacctgaaagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attgttaacctgaaagaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgttaacctgaaagagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttaacctgaaagagaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttaacctgaaagagaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaacctgaaagagaaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taacctgaaagagaaggta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacctgaaagagaaggtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acctgaaagagaaggtagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctgaaagagaaggtagcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgaaagagaaggtagccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaaagagaaggtagccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaagagaaggtagcccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagagaaggtagcccagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagagaaggtagcccagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agagaaggtagcccagctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagaaggtagcccagcttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaaggtagcccagcttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaggtagcccagcttgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggtagcccagcttgaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggtagcccagcttgaagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtagcccagcttgaagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtagcccagcttgaagcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagcccagcttgaagcaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcccagcttgaagcacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcccagcttgaagcacagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccagcttgaagcacagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagcttgaagcacagtgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagcttgaagcacagtgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcttgaagcacagtgcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcttgaagcacagtgccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgaagcacagtgccagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaagcacagtgccagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaagcacagtgccaggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagcacagtgccaggaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagcacagtgccaggaacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcacagtgccaggaacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcacagtgccaggaacctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacagtgccaggaaccttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagtgccaggaaccttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtgccaggaaccttgca 38 RNA PAT source 1..38 mol_type other RNA organism synthetic construct agtgccaggaaccttgcaaagtgccaggaaccttgcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgccaggaaccttgcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgccaggaaccttgcaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccaggaaccttgcaaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaggaaccttgcaaagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggaaccttgcaaagaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggaaccttgcaaagacac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaaccttgcaaagacacg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaccttgcaaagacacgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaccttgcaaagacacggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accttgcaaagacacggtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttgcaaagacacggtgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgcaaagacacggtgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgcaaagacacggtgcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcaaagacacggtgcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaaagacacggtgcaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaagacacggtgcaaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagacacggtgcaaatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagacacggtgcaaatcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agacacggtgcaaatccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacacggtgcaaatccatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acacggtgcaaatccatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacggtgcaaatccatgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acggtgcaaatccatgata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cggtgcaaatccatgatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtgcaaatccatgatatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgcaaatccatgatatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcaaatccatgatatcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaaatccatgatatcact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaatccatgatatcactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatccatgatatcactgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatccatgatatcactggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atccatgatatcactggga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccatgatatcactgggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccatgatatcactgggaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catgatatcactgggaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgatatcactgggaaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatatcactgggaaagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatatcactgggaaagatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatcactgggaaagattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcactgggaaagattgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcactgggaaagattgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcactgggaaagattgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cactgggaaagattgtcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgggaaagattgtcaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgggaaagattgtcaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggaaagattgtcaagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggaaagattgtcaagaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaaagattgtcaagacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaagattgtcaagacatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagattgtcaagacattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagattgtcaagacattgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agattgtcaagacattgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gattgtcaagacattgcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attgtcaagacattgccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtcaagacattgccaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtcaagacattgccaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcaagacattgccaataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaagacattgccaataag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caagacattgccaataagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagacattgccaataaggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agacattgccaataaggga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacattgccaataagggag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acattgccaataagggagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cattgccaataagggagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attgccaataagggagcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgccaataagggagctaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgccaataagggagctaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccaataagggagctaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaataagggagctaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caataagggagctaaacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aataagggagctaaacaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataagggagctaaacagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagggagctaaacagagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagggagctaaacagagcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agggagctaaacagagcgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggagctaaacagagcggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagctaaacagagcgggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagctaaacagagcgggct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agctaaacagagcgggctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctaaacagagcgggcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctaaacagagcgggcttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaacagagcgggctttac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaacagagcgggctttact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacagagcgggctttactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagagcgggctttacttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagagcgggctttacttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agagcgggctttactttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagcgggctttactttatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcgggctttactttatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcgggctttactttattaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgggctttactttattaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggctttactttattaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggctttactttattaaacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctttactttattaaacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttactttattaaacctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttactttattaaacctct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttactttattaaacctctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactttattaaacctctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actttattaaacctctgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttattaaacctctgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttattaaacctctgaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttattaaacctctgaaagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tattaaacctctgaaagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attaaacctctgaaagcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaaacctctgaaagctaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaacctctgaaagctaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaacctctgaaagctaacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacctctgaaagctaacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acctctgaaagctaaccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctctgaaagctaaccagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctctgaaagctaaccagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgaaagctaaccagcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgaaagctaaccagcaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaaagctaaccagcaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaagctaaccagcaattc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagctaaccagcaattct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagctaaccagcaattctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agctaaccagcaattctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctaaccagcaattcttag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctaaccagcaattcttagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaccagcaattcttagtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaccagcaattcttagtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accagcaattcttagtcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagcaattcttagtctac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagcaattcttagtctact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcaattcttagtctactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaattcttagtctactgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caattcttagtctactgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattcttagtctactgtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attcttagtctactgtgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcttagtctactgtgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttagtctactgtgaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttagtctactgtgaaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttagtctactgtgaaatcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagtctactgtgaaatcga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtctactgtgaaatcgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctactgtgaaatcgatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctactgtgaaatcgatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctactgtgaaatcgatggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactgtgaaatcgatgggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgtgaaatcgatgggtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtgaaatcgatgggtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgaaatcgatgggtctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgaaatcgatgggtctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaaatcgatgggtctgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaatcgatgggtctggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatcgatgggtctggaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatcgatgggtctggaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcgatgggtctggaaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgatgggtctggaaatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgatgggtctggaaatgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgggtctggaaatggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgggtctggaaatggatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggtctggaaatggatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggtctggaaatggatgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtctggaaatggatggac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctggaaatggatggact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctggaaatggatggactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggaaatggatggactgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggaaatggatggactgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaaatggatggactgtgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaatggatggactgtgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatggatggactgtgttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatggatggactgtgtttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggatggactgtgtttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggatggactgtgtttcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggatggactgtgtttcaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatggactgtgtttcagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggactgtgtttcagaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggactgtgtttcagaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggactgtgtttcagaagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gactgtgtttcagaagaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgtgtttcagaagagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtgtttcagaagagact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgtttcagaagagactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgtttcagaagagacttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttcagaagagacttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttcagaagagacttgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcagaagagacttgatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcagaagagacttgatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagaagagacttgatggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagaagagacttgatggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaagagacttgatggcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagagacttgatggcagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagagacttgatggcagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agagacttgatggcagtgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagacttgatggcagtgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agacttgatggcagtgtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacttgatggcagtgtaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttgatggcagtgtagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgatggcagtgtagatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgatggcagtgtagattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatggcagtgtagatttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatggcagtgtagatttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggcagtgtagatttcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggcagtgtagatttcaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcagtgtagatttcaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcagtgtagatttcaagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtgtagatttcaagaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtgtagatttcaagaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgtagatttcaagaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtagatttcaagaaaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtagatttcaagaaaaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagatttcaagaaaaactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agatttcaagaaaaactgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatttcaagaaaaactgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttcaagaaaaactggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcaagaaaaactggatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaagaaaaactggattc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaagaaaaactggattca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caagaaaaactggattcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagaaaaactggattcaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaaaaactggattcaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaaaactggattcaatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaactggattcaatata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaactggattcaatataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaactggattcaatataaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aactggattcaatataaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actggattcaatataaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggattcaatataaagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggattcaatataaagaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggattcaatataaagaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gattcaatataaagaagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attcaatataaagaaggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaatataaagaaggatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaatataaagaaggattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caatataaagaaggatttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatataaagaaggatttgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atataaagaaggatttgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tataaagaaggatttggac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataaagaaggatttggaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaagaaggatttggacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagaaggatttggacatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagaaggatttggacatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaaggatttggacatctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaggatttggacatctgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggatttggacatctgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggatttggacatctgtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggatttggacatctgtctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatttggacatctgtctcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttggacatctgtctcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttggacatctgtctccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggacatctgtctcctac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggacatctgtctcctact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggacatctgtctcctactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacatctgtctcctactgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acatctgtctcctactggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catctgtctcctactggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctgtctcctactggcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgtctcctactggcaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtctcctactggcacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtctcctactggcacaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctcctactggcacaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctcctactggcacaacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcctactggcacaacaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctactggcacaacagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctactggcacaacagaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctactggcacaacagaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactggcacaacagaattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actggcacaacagaatttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggcacaacagaattttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggcacaacagaattttgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcacaacagaattttggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcacaacagaattttggct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacaacagaattttggctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaacagaattttggctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caacagaattttggctggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacagaattttggctggga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagaattttggctgggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagaattttggctgggaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaattttggctgggaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaattttggctgggaaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattttggctgggaaatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attttggctgggaaatgag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttggctgggaaatgaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttggctgggaaatgagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggctgggaaatgagaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggctgggaaatgagaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggctgggaaatgagaagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgggaaatgagaagatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgggaaatgagaagattc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggaaatgagaagattca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggaaatgagaagattcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaaatgagaagattcatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaatgagaagattcattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatgagaagattcatttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatgagaagattcatttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgagaagattcatttgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgagaagattcatttgata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagaagattcatttgataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaagattcatttgataag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagattcatttgataagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagattcatttgataagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agattcatttgataagcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gattcatttgataagcaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attcatttgataagcacac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcatttgataagcacaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatttgataagcacacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catttgataagcacacagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttgataagcacacagtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgataagcacacagtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgataagcacacagtctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgataagcacacagtctgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gataagcacacagtctgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataagcacacagtctgcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagcacacagtctgccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagcacacagtctgccatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcacacagtctgccatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcacacagtctgccatccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacacagtctgccatccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acacagtctgccatcccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacagtctgccatcccata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagtctgccatcccatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtctgccatcccatatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtctgccatcccatatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctgccatcccatatgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgccatcccatatgcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgccatcccatatgcatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgccatcccatatgcatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccatcccatatgcattaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccatcccatatgcattaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcccatatgcattaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcccatatgcattaagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcccatatgcattaagagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccatatgcattaagagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccatatgcattaagagtgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catatgcattaagagtgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatgcattaagagtggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgcattaagagtggaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgcattaagagtggaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcattaagagtggaactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcattaagagtggaactgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cattaagagtggaactgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attaagagtggaactggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaagagtggaactggaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagagtggaactggaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagagtggaactggaagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agagtggaactggaagact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagtggaactggaagactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtggaactggaagactgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtggaactggaagactgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggaactggaagactggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaactggaagactggaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaactggaagactggaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aactggaagactggaatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actggaagactggaatggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggaagactggaatggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggaagactggaatggcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaagactggaatggcaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagactggaatggcagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagactggaatggcagaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agactggaatggcagaacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gactggaatggcagaacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actggaatggcagaaccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggaatggcagaaccagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggaatggcagaaccagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaatggcagaaccagtac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaatggcagaaccagtact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatggcagaaccagtactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggcagaaccagtactgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggcagaaccagtactgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcagaaccagtactgcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcagaaccagtactgcaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagaaccagtactgcagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaaccagtactgcagact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaccagtactgcagacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaccagtactgcagactat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accagtactgcagactatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagtactgcagactatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtactgcagactatgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtactgcagactatgcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtactgcagactatgccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactgcagactatgccatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgcagactatgccatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgcagactatgccatgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcagactatgccatgttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcagactatgccatgttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagactatgccatgttcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agactatgccatgttcaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gactatgccatgttcaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actatgccatgttcaaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctatgccatgttcaaggtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgccatgttcaaggtgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgccatgttcaaggtggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgccatgttcaaggtggga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccatgttcaaggtgggac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccatgttcaaggtgggacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catgttcaaggtgggacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgttcaaggtgggacctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttcaaggtgggacctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttcaaggtgggacctgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaaggtgggacctgaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaggtgggacctgaagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaggtgggacctgaagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggtgggacctgaagctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggtgggacctgaagctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtgggacctgaagctgac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgggacctgaagctgaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggacctgaagctgacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggacctgaagctgacaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggacctgaagctgacaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacctgaagctgacaagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acctgaagctgacaagtac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctgaagctgacaagtacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgaagctgacaagtaccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaagctgacaagtaccgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagctgacaagtaccgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagctgacaagtaccgcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agctgacaagtaccgccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgacaagtaccgcctaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgacaagtaccgcctaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacaagtaccgcctaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacaagtaccgcctaacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaagtaccgcctaacata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caagtaccgcctaacatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtaccgcctaacatatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtaccgcctaacatatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaccgcctaacatatgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taccgcctaacatatgcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accgcctaacatatgccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgcctaacatatgcctac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgcctaacatatgcctact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcctaacatatgcctactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctaacatatgcctacttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctaacatatgcctacttcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taacatatgcctacttcgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacatatgcctacttcgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acatatgcctacttcgctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catatgcctacttcgctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatgcctacttcgctggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgcctacttcgctggtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgcctacttcgctggtgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcctacttcgctggtggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcctacttcgctggtgggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctacttcgctggtgggga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctacttcgctggtggggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacttcgctggtggggatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttcgctggtggggatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttcgctggtggggatgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcgctggtggggatgctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgctggtggggatgctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgctggtggggatgctgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctggtggggatgctggag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggtggggatgctggaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggtggggatgctggagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtggggatgctggagatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtggggatgctggagatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggggatgctggagatgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggggatgctggagatgcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggatgctggagatgcctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggatgctggagatgccttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgctggagatgcctttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgctggagatgcctttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgctggagatgcctttgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctggagatgcctttgatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggagatgcctttgatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggagatgcctttgatggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagatgcctttgatggct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagatgcctttgatggctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agatgcctttgatggcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgcctttgatggctttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgcctttgatggctttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcctttgatggctttgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcctttgatggctttgatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctttgatggctttgattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttgatggctttgatttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgatggctttgattttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgatggctttgattttgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatggctttgattttggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatggctttgattttggcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggctttgattttggcga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggctttgattttggcgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggctttgattttggcgatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctttgattttggcgatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttgattttggcgatgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgattttggcgatgatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgattttggcgatgatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgattttggcgatgatcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gattttggcgatgatccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attttggcgatgatcctag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttggcgatgatcctagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttggcgatgatcctagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggcgatgatcctagtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggcgatgatcctagtgac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcgatgatcctagtgaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcgatgatcctagtgacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgatgatcctagtgacaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgatcctagtgacaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgatcctagtgacaagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatcctagtgacaagttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatcctagtgacaagtttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcctagtgacaagttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctagtgacaagtttttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctagtgacaagtttttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctagtgacaagtttttcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagtgacaagtttttcaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtgacaagtttttcacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgacaagtttttcacatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacaagtttttcacatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacaagtttttcacatccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaagtttttcacatccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caagtttttcacatcccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtttttcacatcccata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtttttcacatcccataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttttcacatcccataat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttttcacatcccataatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttcacatcccataatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcacatcccataatggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcacatcccataatggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcacatcccataatggcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacatcccataatggcatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acatcccataatggcatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcccataatggcatgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcccataatggcatgcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcccataatggcatgcagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccataatggcatgcagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccataatggcatgcagttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cataatggcatgcagttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataatggcatgcagttcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatggcatgcagttcagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatggcatgcagttcagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggcatgcagttcagtac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggcatgcagttcagtacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcatgcagttcagtacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcatgcagttcagtacctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catgcagttcagtacctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgcagttcagtacctggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcagttcagtacctggga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcagttcagtacctgggac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagttcagtacctgggaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttcagtacctgggacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttcagtacctgggacaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcagtacctgggacaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagtacctgggacaatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtacctgggacaatgac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtacctgggacaatgaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtacctgggacaatgacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacctgggacaatgacaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acctgggacaatgacaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctgggacaatgacaatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgggacaatgacaatgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggacaatgacaatgata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggacaatgacaatgataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggacaatgacaatgataag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacaatgacaatgataagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaatgacaatgataagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caatgacaatgataagttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatgacaatgataagtttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgacaatgataagtttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacaatgataagtttgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacaatgataagtttgaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaatgataagtttgaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caatgataagtttgaaggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatgataagtttgaaggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgataagtttgaaggcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgataagtttgaaggcaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gataagtttgaaggcaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataagtttgaaggcaactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagtttgaaggcaactgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtttgaaggcaactgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtttgaaggcaactgtgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttgaaggcaactgtgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgaaggcaactgtgctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaaggcaactgtgctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaaggcaactgtgctgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaggcaactgtgctgaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggcaactgtgctgaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggcaactgtgctgaacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcaactgtgctgaacagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaactgtgctgaacagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caactgtgctgaacaggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aactgtgctgaacaggatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgtgctgaacaggatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtgctgaacaggatgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgctgaacaggatggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgctgaacaggatggatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgctgaacaggatggatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgaacaggatggatctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgaacaggatggatctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaacaggatggatctggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaacaggatggatctggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacaggatggatctggttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaggatggatctggttgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggatggatctggttggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggatggatctggttggtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggatggatctggttggtgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatggatctggttggtgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggatctggttggtggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggatctggttggtggatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggatctggttggtggatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatctggttggtggatgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctggttggtggatgaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctggttggtggatgaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggttggtggatgaacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggttggtggatgaacaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggttggtggatgaacaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttggtggatgaacaagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggtggatgaacaagtgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggtggatgaacaagtgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtggatgaacaagtgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtggatgaacaagtgtcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggatgaacaagtgtcacg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggatgaacaagtgtcacgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaacaagtgtcacgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgaacaagtgtcacgctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaacaagtgtcacgctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaacaagtgtcacgctggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacaagtgtcacgctggcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaagtgtcacgctggcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caagtgtcacgctggccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtgtcacgctggccatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtgtcacgctggccatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgtcacgctggccatctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtcacgctggccatctca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcacgctggccatctcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcacgctggccatctcaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacgctggccatctcaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acgctggccatctcaatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgctggccatctcaatgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctggccatctcaatggag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggccatctcaatggagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggccatctcaatggagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggccatctcaatggagttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccatctcaatggagttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccatctcaatggagtttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catctcaatggagtttatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctcaatggagtttatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctcaatggagtttattac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcaatggagtttattacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaatggagtttattacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caatggagtttattaccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatggagtttattaccaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggagtttattaccaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggagtttattaccaaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagtttattaccaaggtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagtttattaccaaggtgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtttattaccaaggtggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttattaccaaggtggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttattaccaaggtggcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttattaccaaggtggcact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tattaccaaggtggcactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attaccaaggtggcactta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaccaaggtggcacttac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taccaaggtggcacttact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accaaggtggcacttactc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaaggtggcacttactca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaggtggcacttactcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggtggcacttactcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggtggcacttactcaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtggcacttactcaaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtggcacttactcaaaagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggcacttactcaaaagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcacttactcaaaagcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcacttactcaaaagcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacttactcaaaagcatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttactcaaaagcatcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttactcaaaagcatctac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttactcaaaagcatctact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactcaaaagcatctactc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actcaaaagcatctactcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcaaaagcatctactcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaaagcatctactccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaaagcatctactcctaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaagcatctactcctaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagcatctactcctaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagcatctactcctaatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcatctactcctaatggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcatctactcctaatggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catctactcctaatggtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctactcctaatggttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctactcctaatggttatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctactcctaatggttatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactcctaatggttatgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actcctaatggttatgata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcctaatggttatgataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctaatggttatgataat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctaatggttatgataatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctaatggttatgataatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatggttatgataatggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatggttatgataatggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggttatgataatggcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggttatgataatggcatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggttatgataatggcatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttatgataatggcattat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatgataatggcattatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgataatggcattattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgataatggcattatttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgataatggcattatttgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gataatggcattatttggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataatggcattatttgggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatggcattatttgggcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatggcattatttgggcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggcattatttgggccac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggcattatttgggccact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcattatttgggccactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcattatttgggccacttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cattatttgggccacttgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attatttgggccacttgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatttgggccacttggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatttgggccacttggaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttgggccacttggaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgggccacttggaaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgggccacttggaaaacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggccacttggaaaaccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggccacttggaaaacccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggccacttggaaaacccgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccacttggaaaacccggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccacttggaaaacccggtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacttggaaaacccggtgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttggaaaacccggtggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttggaaaacccggtggta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggaaaacccggtggtat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggaaaacccggtggtatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaaaacccggtggtattc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaaacccggtggtattcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaacccggtggtattcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaacccggtggtattccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacccggtggtattccatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acccggtggtattccatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccggtggtattccatgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccggtggtattccatgaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cggtggtattccatgaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtggtattccatgaagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtggtattccatgaagaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggtattccatgaagaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtattccatgaagaaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtattccatgaagaaaacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tattccatgaagaaaacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attccatgaagaaaaccac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttccatgaagaaaaccact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccatgaagaaaaccacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccatgaagaaaaccactat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catgaagaaaaccactatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgaagaaaaccactatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaagaaaaccactatgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagaaaaccactatgaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagaaaaccactatgaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaaaaccactatgaagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaaaccactatgaagata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaccactatgaagataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaccactatgaagataat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaccactatgaagataatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accactatgaagataatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccactatgaagataatccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cactatgaagataatccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actatgaagataatcccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctatgaagataatcccatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgaagataatcccattc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgaagataatcccattca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaagataatcccattcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagataatcccattcaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagataatcccattcaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agataatcccattcaacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gataatcccattcaacaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataatcccattcaacagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatcccattcaacagact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatcccattcaacagactc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcccattcaacagactca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcccattcaacagactcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccattcaacagactcaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccattcaacagactcacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cattcaacagactcacaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attcaacagactcacaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaacagactcacaattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaacagactcacaattgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caacagactcacaattgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacagactcacaattggag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagactcacaattggaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagactcacaattggagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agactcacaattggagaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gactcacaattggagaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actcacaattggagaagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcacaattggagaaggac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcacaattggagaaggaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacaattggagaaggacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaattggagaaggacagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caattggagaaggacagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattggagaaggacagcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attggagaaggacagcaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggagaaggacagcaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggagaaggacagcaacac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagaaggacagcaacacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagaaggacagcaacacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaaggacagcaacaccac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaggacagcaacaccacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggacagcaacaccacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggacagcaacaccacctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggacagcaacaccacctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacagcaacaccacctggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagcaacaccacctgggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagcaacaccacctggggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcaacaccacctgggggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaacaccacctgggggga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caacaccacctggggggag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacaccacctggggggagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaccacctggggggagcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caccacctggggggagcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accacctggggggagccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccacctggggggagccaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacctggggggagccaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acctggggggagccaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctggggggagccaaacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggggggagccaaacagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggggggagccaaacaggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggggggagccaaacaggct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggggagccaaacaggctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggggagccaaacaggctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggagccaaacaggctgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagccaaacaggctggag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagccaaacaggctggaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agccaaacaggctggagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccaaacaggctggagacg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaaacaggctggagacgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaacaggctggagacgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaacaggctggagacgttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacaggctggagacgttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaggctggagacgtttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggctggagacgtttaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggctggagacgtttaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggctggagacgtttaaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctggagacgtttaaaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggagacgtttaaaagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggagacgtttaaaagacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagacgtttaaaagaccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagacgtttaaaagaccgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agacgtttaaaagaccgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacgtttaaaagaccgttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acgtttaaaagaccgtttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgtttaaaagaccgtttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttaaaagaccgtttcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttaaaagaccgtttcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaaaagaccgtttcaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaaagaccgtttcaaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaagaccgtttcaaaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagaccgtttcaaaagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagaccgtttcaaaagaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaccgtttcaaaagagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaccgtttcaaaagagatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accgtttcaaaagagattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgtttcaaaagagattta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgtttcaaaagagatttac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttcaaaagagatttact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcaaaagagatttactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaaaagagatttacttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaaagagatttactttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaaagagatttacttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaagagatttactttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagagatttactttttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagagatttacttttttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agagatttacttttttaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagatttacttttttaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agatttacttttttaaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatttacttttttaaagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttacttttttaaaggac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttacttttttaaaggact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttacttttttaaaggactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacttttttaaaggacttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttttttaaaggacttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttttttaaaggactttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttttaaaggactttatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttttaaaggactttatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttaaaggactttatctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttaaaggactttatctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaaaggactttatctgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaaggactttatctgaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaggactttatctgaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggactttatctgaacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggactttatctgaacaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggactttatctgaacagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gactttatctgaacagaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actttatctgaacagagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttatctgaacagagaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttatctgaacagagagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatctgaacagagagata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatctgaacagagagatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctgaacagagagatata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgaacagagagatataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgaacagagagatataat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaacagagagatataata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaacagagagatataatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacagagagatataatatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagagagatataatattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagagagatataatatttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agagagatataatattttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagagatataatatttttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agagatataatatttttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagatataatatttttcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agatataatatttttccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatataatatttttcctat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atataatatttttcctatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tataatatttttcctattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataatatttttcctattgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatatttttcctattgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatatttttcctattggac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatttttcctattggaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatttttcctattggacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttttcctattggacaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttttcctattggacaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttcctattggacaatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcctattggacaatgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcctattggacaatggac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctattggacaatggact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctattggacaatggactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctattggacaatggacttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tattggacaatggacttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attggacaatggacttgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggacaatggacttgcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggacaatggacttgcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggacaatggacttgcaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacaatggacttgcaaagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaatggacttgcaaagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caatggacttgcaaagctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatggacttgcaaagcttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggacttgcaaagcttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggacttgcaaagcttcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggacttgcaaagcttcact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacttgcaaagcttcactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttgcaaagcttcacttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgcaaagcttcacttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgcaaagcttcacttcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcaaagcttcacttcatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaaagcttcacttcattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaagcttcacttcatttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagcttcacttcatttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagcttcacttcattttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcttcacttcattttaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcttcacttcattttaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttcacttcattttaagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcacttcattttaagagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcacttcattttaagagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacttcattttaagagcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttcattttaagagcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttcattttaagagcaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcattttaagagcaaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcattttaagagcaaaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cattttaagagcaaaagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attttaagagcaaaagacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttaagagcaaaagaccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttaagagcaaaagacccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaagagcaaaagacccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagagcaaaagaccccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagagcaaaagaccccatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agagcaaaagaccccatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagcaaaagaccccatgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcaaaagaccccatgttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaaaagaccccatgttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaaagaccccatgttgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaagaccccatgttgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagaccccatgttgaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagaccccatgttgaaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaccccatgttgaaaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaccccatgttgaaaactc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accccatgttgaaaactcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccccatgttgaaaactcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccatgttgaaaactccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccatgttgaaaactccata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catgttgaaaactccataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgttgaaaactccataac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttgaaaactccataaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttgaaaactccataacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaaaactccataacagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaaaactccataacagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaaactccataacagttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaactccataacagtttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaactccataacagtttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aactccataacagttttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actccataacagttttatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctccataacagttttatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccataacagttttatgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccataacagttttatgctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cataacagttttatgctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataacagttttatgctgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taacagttttatgctgatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacagttttatgctgatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagttttatgctgatgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagttttatgctgatgata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttttatgctgatgataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttttatgctgatgataat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttatgctgatgataatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttatgctgatgataattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatgctgatgataattta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgctgatgataatttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgctgatgataatttatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgctgatgataatttatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgatgataatttatcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgatgataatttatctac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgataatttatctaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgataatttatctacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgataatttatctacatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgataatttatctacatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gataatttatctacatgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataatttatctacatgcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatttatctacatgcatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatttatctacatgcattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttatctacatgcatttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttatctacatgcatttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatctacatgcatttcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatctacatgcatttcaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctacatgcatttcaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctacatgcatttcaataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctacatgcatttcaataaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacatgcatttcaataaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acatgcatttcaataaacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catgcatttcaataaacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgcatttcaataaacctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcatttcaataaaccttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcatttcaataaacctttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catttcaataaaccttttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttcaataaaccttttgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcaataaaccttttgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaataaaccttttgttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaataaaccttttgtttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caataaaccttttgtttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aataaaccttttgtttcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataaaccttttgtttccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaaccttttgtttcctaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaccttttgtttcctaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaccttttgtttcctaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accttttgtttcctaagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttttgtttcctaagact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttttgtttcctaagacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttgtttcctaagactag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgtttcctaagactaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttgaagctcctccttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggttgaagctcctcctttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggttgaagctcctccttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggttgaagctcctcctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaggttgaagctcctcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacaggttgaagctcctcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acacaggttgaagctcctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacacaggttgaagctcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcacacaggttgaagctcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcacacaggttgaagctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgcacacaggttgaagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgcacacaggttgaagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttgcacacaggttgaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attttgcacacaggttgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gattttgcacacaggttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agattttgcacacaggttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagattttgcacacaggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagattttgcacacaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccagattttgcacacagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcccagattttgcacacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcccagattttgcacaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttcccagattttgcacac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggttcccagattttgcaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggttcccagattttgcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggttcccagattttgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaggttcccagattttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcaggttcccagattttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtcaggttcccagatttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtcaggttcccagattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgtcaggttcccagatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactgtcaggttcccagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atactgtcaggttcccaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatactgtcaggttcccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctatactgtcaggttccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctatactgtcaggttccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acctatactgtcaggttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacctatactgtcaggttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caacctatactgtcaggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaacctatactgtcaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccaacctatactgtcagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccccaacctatactgtcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccccaacctatactgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcccccaacctatactgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcccccaacctatactgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggcccccaacctatactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggcccccaacctatact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctggcccccaacctatac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctggcccccaacctata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcctggcccccaacctat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcctggcccccaaccta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatcctggcccccaacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcatcctggcccccaacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctcatcctggcccccaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctcatcctggcccccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcctcatcctggccccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcctcatcctggccccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttcctcatcctggcccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttttcctcatcctggccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttttcctcatcctggcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctttttcctcatcctggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctttttcctcatcctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcctttttcctcatcctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttcctttttcctcatcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgttcctttttcctcatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgttcctttttcctcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccgttcctttttcctcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcccgttcctttttcctca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcccgttcctttttcctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcccgttcctttttcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttcccgttcctttttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctttcccgttcctttttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctttcccgttccttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtctttcccgttcctttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggtctttcccgttccttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggtctttcccgttcctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaggtctttcccgttcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcaggtctttcccgttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggcaggtctttcccgttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggcaggtctttcccgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgggcaggtctttcccgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtgggcaggtctttcccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggtgggcaggtctttccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agggtgggcaggtctttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagggtgggcaggtctttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagggtgggcaggtcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaagggtgggcaggtctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagaagggtgggcaggtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagaagggtgggcaggtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accagaagggtgggcaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taccagaagggtgggcagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaccagaagggtgggcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttaccagaagggtgggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttaccagaagggtgggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccttaccagaagggtggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctccttaccagaagggtgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctccttaccagaagggtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcctccttaccagaagggt 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct ggcctccttaccagaaggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggcctccttaccagaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggggcctccttaccagaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cggggcctccttaccagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acggggcctccttaccaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacggggcctccttaccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcacggggcctccttacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcacggggcctccttacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatcacggggcctccttac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatcacggggcctcctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgatcacggggcctcctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgatcacggggcctcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agctgatcacggggcctcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagctgatcacggggcctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagctgatcacggggcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggagctgatcacggggcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggagctgatcacggggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctggagctgatcacgggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggctggagctgatcacggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggctggagctgatcacgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggctggagctgatcacg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatggctggagctgatcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatggctggagctgatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaatggctggagctgatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaaatggctggagctgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcaaatggctggagctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgcaaatggctggagctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgcaaatggctggagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gactgcaaatggctggagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggactgcaaatggctggag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggactgcaaatggctgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggactgcaaatggctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaggactgcaaatggctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccaggactgcaaatggct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agccaggactgcaaatggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagccaggactgcaaatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atagccaggactgcaaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatagccaggactgcaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggatagccaggactgcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggatagccaggactgcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggatagccaggactgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgggatagccaggactgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctgggatagccaggactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctgggatagccaggact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcctgggatagccaggac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctcctgggatagccagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agctcctgggatagccagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagctcctgggatagccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagctcctgggatagcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaagctcctgggatagcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtaagctcctgggatagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgtaagctcctgggatag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgtaagctcctgggata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatgtaagctcctgggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttatgtaagctcctggga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttatgtaagctcctggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctttatgtaagctcctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccctttatgtaagctcctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccctttatgtaagctcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtccctttatgtaagctcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtccctttatgtaagctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtccctttatgtaagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attgtccctttatgtaagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattgtccctttatgtaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caattgtccctttatgtaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaattgtccctttatgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccaattgtccctttatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctccaattgtccctttatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctccaattgtccctttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggctccaattgtcccttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggctccaattgtcccttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggctccaattgtccctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaggctccaattgtccct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcaggctccaattgtccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctcaggctccaattgtcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctctcaggctccaattgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctctcaggctccaattgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acctctcaggctccaattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacctctcaggctccaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcacctctcaggctccaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcacctctcaggctccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtcacctctcaggctcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtcacctctcaggctcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgtcacctctcaggctc 38 RNA PAT source 1..38 mol_type other RNA organism synthetic construct cactgtcacctctcaggctcactgtcacctctcaggct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcactgtcacctctcaggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcactgtcacctctcagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagcactgtcacctctcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagcactgtcacctctca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcagcactgtcacctctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtcagcactgtcacctct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgtcagcactgtcacctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtgtcagcactgtcacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagtgtcagcactgtcacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtagtgtcagcactgtcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtagtgtcagcactgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtagtgtcagcactgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgtagtgtcagcactgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttgtagtgtcagcactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccttgtagtgtcagcact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agccttgtagtgtcagcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagccttgtagtgtcagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgagccttgtagtgtcagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgagccttgtagtgtcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccgagccttgtagtgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctccgagccttgtagtgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctccgagccttgtagtgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agctccgagccttgtagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagctccgagccttgtagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagctccgagccttgtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cggagctccgagccttgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccggagctccgagccttgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccggagctccgagccttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcccggagctccgagcctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcccggagctccgagcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgcccggagctccgagcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtgcccggagctccgagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagtgcccggagctccgag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgagtgcccggagctccga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgagtgcccggagctccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgagtgcccggagctcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctgagtgcccggagctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtctgagtgcccggagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgtctgagtgcccggagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgtctgagtgcccggag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgtctgagtgcccgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgatgtctgagtgcccgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catgatgtctgagtgcccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatgatgtctgagtgccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcatgatgtctgagtgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actcatgatgtctgagtgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aactcatgatgtctgagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caactcatgatgtctgagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaactcatgatgtctgag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accaactcatgatgtctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaccaactcatgatgtctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaccaactcatgatgtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggaccaactcatgatgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggaccaactcatgatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaggaccaactcatgatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaaggaccaactcatgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcaaggaccaactcatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgcaaggaccaactcatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtgcaaggaccaactcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggtgcaaggaccaactca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggggtgcaaggaccaactc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggggtgcaaggaccaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgggggtgcaaggaccaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgggggtgcaaggaccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccgggggtgcaaggacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttccgggggtgcaaggacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attccgggggtgcaaggac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattccgggggtgcaagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaattccgggggtgcaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaattccgggggtgcaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaaattccgggggtgcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attaaattccgggggtgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattaaattccgggggtgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaattaaattccgggggtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaattaaattccgggggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagaattaaattccggggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agagaattaaattccgggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagagaattaaattccggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtagagaattaaattccgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtagagaattaaattccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtagagaattaaattcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagtagagaattaaattc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaagtagagaattaaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagaagtagagaattaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atagaagtagagaattaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catagaagtagagaattaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcatagaagtagagaatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcatagaagtagagaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagcatagaagtagagaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agagcatagaagtagagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagagcatagaagtagaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagagcatagaagtagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaagagcatagaagtaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaaagagcatagaagtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataaaagagcatagaagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aataaaagagcatagaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaataaaagagcatagaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaataaaagagcatagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaaataaaagagcataga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagaaataaaagagcatag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agagaaataaaagagcata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagagaaataaaagagcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agagagaaataaaagagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagagagaaataaaagagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagagagaaataaaagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaagagagaaataaaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaagagagaaataaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttgaagagagaaataaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttgaagagagaaataaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgttgaagagagaaataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catgttgaagagagaaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acatgttgaagagagaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacatgttgaagagagaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acacatgttgaagagagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacacatgttgaagagaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctacacatgttgaagagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctacacatgttgaagaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgctacacatgttgaagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgctacacatgttgaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgctacacatgttgaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatgctacacatgttgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catatgctacacatgttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acatatgctacacatgttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacatatgctacacatgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caacatatgctacacatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaacatatgctacacatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcaacatatgctacacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagcaacatatgctacaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtagcaacatatgctacac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtagcaacatatgctaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggtagcaacatatgctac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggtagcaacatatgcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctggtagcaacatatgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctctggtagcaacatatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctctggtagcaacatatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctctggtagcaacatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtctctggtagcaacata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtctctggtagcaacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttgtctctggtagcaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttgtctctggtagcaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagttgtctctggtagcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcagttgtctctggtagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcagttgtctctggtagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagcagttgtctctggtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcagcagttgtctctggta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcagcagttgtctctggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgcagcagttgtctctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgcagcagttgtctctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agatgcagcagttgtctct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagatgcagcagttgtctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagatgcagcagttgtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctaagatgcagcagttgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctaagatgcagcagttgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctaagatgcagcagttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catctaagatgcagcagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatctaagatgcagcagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcatctaagatgcagcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcatctaagatgcagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttcatctaagatgcagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctttcatctaagatgcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctttcatctaagatgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatctttcatctaagatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaatctttcatctaagatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgaatctttcatctaagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgaatctttcatctaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accgaatctttcatctaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taccgaatctttcatctaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctaccgaatctttcatcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actaccgaatctttcatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taactaccgaatctttcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataactaccgaatctttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aataactaccgaatctttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caataactaccgaatcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaataactaccgaatctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacaataactaccgaatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggacaataactaccgaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggacaataactaccgaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggacaataactaccgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttggacaataactaccga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttggacaataactaccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagttggacaataactacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtagttggacaataactac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtagttggacaataacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggtagttggacaataact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggtagttggacaataac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaggtagttggacaataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacaggtagttggacaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccacaggtagttggacaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccacaggtagttggacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgccacaggtagttggaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgccacaggtagttggac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatgccacaggtagttgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caatgccacaggtagttgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaatgccacaggtagttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcaatgccacaggtagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgcaatgccacaggtagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgcaatgccacaggtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctgcaatgccacaggta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatctgcaatgccacaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatctgcaatgccacagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaatctgcaatgccacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaaatctgcaatgccaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggaaatctgcaatgccac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggaaatctgcaatgcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaggaaatctgcaatgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacaggaaatctgcaatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agacaggaaatctgcaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagacaggaaatctgcaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtagacaggaaatctgcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtagacaggaaatctgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtagacaggaaatctgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagtagacaggaaatctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataagtagacaggaaatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gataagtagacaggaaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgataagtagacaggaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgataagtagacaggaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgataagtagacaggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttgataagtagacagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtttgataagtagacagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggtttgataagtagacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggtttgataagtagaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttggtttgataagtagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttggtttgataagtaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actttggtttgataagtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactttggtttgataagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctactttggtttgataagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctactttggtttgataag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctactttggtttgataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtctactttggtttgata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtctactttggtttgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgtctactttggtttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttgtctactttggtttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccttgtctactttggttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atccttgtctactttggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatccttgtctactttggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agatccttgtctactttgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagatccttgtctactttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtagatccttgtctacttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtagatccttgtctactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtagatccttgtctact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgtagatccttgtctac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gactgtagatccttgtcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agactgtagatccttgtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagactgtagatccttgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagactgtagatccttgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaagactgtagatccttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaaagactgtagatcctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccaaagactgtagatcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttccaaagactgtagatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttccaaagactgtagatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttccaaagactgtagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcttccaaagactgtaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtcttccaaagactgtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgtcttccaaagactgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgtcttccaaagactgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agatgtcttccaaagactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagatgtcttccaaagact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagatgtcttccaaagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaagatgtcttccaaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtaagatgtcttccaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgtaagatgtcttccaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgtaagatgtcttccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgtaagatgtcttcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgatgtaagatgtcttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgatgtaagatgtcttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttgatgtaagatgtctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacttgatgtaagatgtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caacttgatgtaagatgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaacttgatgtaagatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaacttgatgtaagatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcaacttgatgtaagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttcaacttgatgtaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttttcaacttgatgtaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttttcaacttgatgtaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgttttcaacttgatgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgttttcaacttgatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttgttttcaacttgatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttttgttttcaacttgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttttgttttcaacttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgttttgttttcaacttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgttttgttttcaactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgttttgttttcaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgatgttttgttttcaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgatgttttgttttcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctgatgttttgttttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttctgatgttttgttttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttctgatgttttgtttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacttctgatgttttgttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacttctgatgttttgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgacttctgatgttttgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgacttctgatgttttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttgacttctgatgtttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttgacttctgatgttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtttgacttctgatgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgtttgacttctgatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agctgtttgacttctgatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagctgtttgacttctgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagctgtttgacttctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcagctgtttgacttctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcagctgtttgacttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatcagctgtttgacttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttatcagctgtttgactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttatcagctgtttgact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttttatcagctgtttgac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcttttatcagctgtttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcttttatcagctgtttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgcttttatcagctgttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attgcttttatcagctgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gattgcttttatcagctgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggattgcttttatcagctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggattgcttttatcagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggattgcttttatcagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttggattgcttttatcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttggattgcttttatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagttggattgcttttatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgagttggattgcttttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgagttggattgctttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtgagttggattgctttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtgagttggattgcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagtgagttggattgctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataagtgagttggattgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tataagtgagttggattgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttataagtgagttggattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attataagtgagttggatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gattataagtgagttggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggattataagtgagttgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggattataagtgagttgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggattataagtgagttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaggattataagtgagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcaggattataagtgagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcaggattataagtgag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatcaggattataagtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcatcaggattataagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attcatcaggattataagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gattcatcaggattataag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgattcatcaggattataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgattcatcaggattata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgattcatcaggattat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgattcatcaggatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgatgattcatcaggatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgatgattcatcaggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttgatgattcatcagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttttgatgattcatcagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggttttgatgattcatcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggttttgatgattcatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggttttgatgattcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttggttttgatgattcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttggttttgatgattca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatttggttttgatgattc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatttggttttgatgatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catatttggttttgatgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatatttggttttgatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcatatttggttttgatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcatatttggttttgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctatcatatttggttttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctatcatatttggttttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctatcatatttggtttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgtctatcatatttggttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcgtctatcatatttggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcgtctatcatatttggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagcgtctatcatatttgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcagcgtctatcatatttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcagcgtctatcatattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagcagcgtctatcatatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtagcagcgtctatcatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtagcagcgtctatcata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtagcagcgtctatcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagtagcagcgtctatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaagtagcagcgtctatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaagtagcagcgtctat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaaagtagcagcgtcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttcaaagtagcagcgtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttcaaagtagcagcgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacttcaaagtagcagcgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggacttcaaagtagcagcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggacttcaaagtagcagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggacttcaaagtagcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctggacttcaaagtagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctggacttcaaagtagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcctggacttcaaagtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcctggacttcaaagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttcctggacttcaaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attttcctggacttcaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cattttcctggacttcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acattttcctggacttcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacattttcctggacttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taacattttcctggacttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctaacattttcctggactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctaacattttcctggact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctaacattttcctggac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttctaacattttcctgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttctaacattttcctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcttctaacattttcctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcttctaacattttcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttcttctaacattttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatttcttctaacattttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatttcttctaacatttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataatttcttctaacattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cataatttcttctaacatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcataatttcttctaacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcataatttcttctaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcataatttcttctaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttcataatttcttctaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatttcataatttcttcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatttcataatttcttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catatttcataatttcttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatatttcataatttctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcatatttcataatttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttcatatttcataatttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcttcatatttcataattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcttcatatttcataatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgcttcatatttcataat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgcttcatatttcataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgatgcttcatatttcata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgatgcttcatatttcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcgatgcttcatatttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatcgatgcttcatatttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatcgatgcttcatattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaatcgatgcttcatatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaaatcgatgcttcatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaaaatcgatgcttcata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttaaaatcgatgcttcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttaaaatcgatgcttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgttaaaatcgatgcttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgttaaaatcgatgctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgtgttaaaatcgatgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catgtgttaaaatcgatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatgtgttaaaatcgatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcatgtgttaaaatcgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtcatgtgttaaaatcga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagtcatgtgttaaaatcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgagtcatgtgttaaaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgagtcatgtgttaaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgagtcatgtgttaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttgagtcatgtgttaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacttgagtcatgtgttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atacttgagtcatgtgtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatacttgagtcatgtgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaatacttgagtcatgtgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgaatacttgagtcatgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgaatacttgagtcatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcgaatacttgagtcatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcgaatacttgagtcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatcgaatacttgagtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatatcgaatacttgagtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatatcgaatacttgagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaatatcgaatacttgag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaaatatcgaatacttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcaaatatcgaatacttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgcaaatatcgaatactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctgcaaatatcgaatact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctgcaaatatcgaatac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcctgcaaatatcgaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcctgcaaatatcgaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttcctgcaaatatcgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatttcctgcaaatatcga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatttcctgcaaatatcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatatttcctgcaaatatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatatttcctgcaaatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatatatttcctgcaaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatatatttcctgcaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attatatatttcctgcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattatatatttcctgcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaattatatatttcctgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaattatatatttcctgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaattatatatttcctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgaattatatatttcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttgaattatatatttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatttgaattatatatttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatttgaattatatattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attatttgaattatatatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gattatttgaattatatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgattatttgaattatata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgattatttgaattatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgattatttgaattata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttgattatttgaattat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttttgattatttgaatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttttgattatttgaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcttttgattatttgaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatcttttgattatttgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caatcttttgattatttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaatcttttgattatttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacaatcttttgattattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taacaatcttttgattatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaacaatcttttgattat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttaacaatcttttgatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggttaacaatcttttgatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggttaacaatcttttgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggttaacaatcttttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaggttaacaatcttttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaggttaacaatctttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcaggttaacaatcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttcaggttaacaatctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctttcaggttaacaatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctctttcaggttaacaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctctttcaggttaacaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctctttcaggttaacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttctctttcaggttaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttctctttcaggttaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accttctctttcaggttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taccttctctttcaggtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctaccttctctttcaggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctaccttctctttcaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggctaccttctctttcagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggctaccttctctttcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggctaccttctctttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgggctaccttctctttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgggctaccttctcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agctgggctaccttctctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagctgggctaccttctct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caagctgggctaccttctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaagctgggctaccttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaagctgggctaccttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttcaagctgggctacctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcttcaagctgggctacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcttcaagctgggctacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgcttcaagctgggctac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgcttcaagctgggcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtgcttcaagctgggct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgtgcttcaagctgggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cactgtgcttcaagctggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcactgtgcttcaagctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcactgtgcttcaagctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggcactgtgcttcaagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggcactgtgcttcaagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctggcactgtgcttcaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctggcactgtgcttcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcctggcactgtgcttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttcctggcactgtgcttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggttcctggcactgtgctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggttcctggcactgtgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggttcctggcactgtgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaggttcctggcactgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaaggttcctggcactgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcaaggttcctggcactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgcaaggttcctggcact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgcaaggttcctggcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttgcaaggttcctggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctttgcaaggttcctggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctttgcaaggttcctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtctttgcaaggttcctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgtctttgcaaggttcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgtgtctttgcaaggttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgtgtctttgcaaggttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accgtgtctttgcaaggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caccgtgtctttgcaaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaccgtgtctttgcaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcaccgtgtctttgcaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgcaccgtgtctttgcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgcaccgtgtctttgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttgcaccgtgtctttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatttgcaccgtgtctttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggatttgcaccgtgtcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggatttgcaccgtgtctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggatttgcaccgtgtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catggatttgcaccgtgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatggatttgcaccgtgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcatggatttgcaccgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcatggatttgcaccgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatcatggatttgcaccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatatcatggatttgcacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatatcatggatttgcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgatatcatggatttgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtgatatcatggatttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtgatatcatggatttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagtgatatcatggattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccagtgatatcatggatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcccagtgatatcatggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcccagtgatatcatgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcccagtgatatcatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttcccagtgatatcatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctttcccagtgatatcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctttcccagtgatatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatctttcccagtgatatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caatctttcccagtgatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaatctttcccagtgata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacaatctttcccagtgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacaatctttcccagtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgacaatctttcccagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgacaatctttcccagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttgacaatctttcccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcttgacaatctttccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtcttgacaatctttccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgtcttgacaatctttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatgtcttgacaatctttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caatgtcttgacaatcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaatgtcttgacaatctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcaatgtcttgacaatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggcaatgtcttgacaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggcaatgtcttgacaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attggcaatgtcttgacaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tattggcaatgtcttgaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttattggcaatgtcttgac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttattggcaatgtcttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttattggcaatgtcttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccttattggcaatgtctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcccttattggcaatgtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcccttattggcaatgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctcccttattggcaatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agctcccttattggcaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagctcccttattggcaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttagctcccttattggcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttagctcccttattggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttagctcccttattggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttagctcccttattgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtttagctcccttattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgtttagctcccttatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctctgtttagctcccttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctctgtttagctccctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgctctgtttagctccctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgctctgtttagctccct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccgctctgtttagctccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcccgctctgtttagctcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcccgctctgtttagctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagcccgctctgtttagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagcccgctctgtttagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaagcccgctctgtttag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaaagcccgctctgttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtaaagcccgctctgttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtaaagcccgctctgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagtaaagcccgctctgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaagtaaagcccgctctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataaagtaaagcccgctct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aataaagtaaagcccgctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taataaagtaaagcccgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaataaagtaaagcccgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttaataaagtaaagcccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttaataaagtaaagccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtttaataaagtaaagcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggtttaataaagtaaagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaggtttaataaagtaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaggtttaataaagtaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagaggtttaataaagtaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagaggtttaataaagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcagaggtttaataaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcagaggtttaataaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttcagaggtttaataaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctttcagaggtttaataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agctttcagaggtttaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagctttcagaggtttaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttagctttcagaggtttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttagctttcagaggttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggttagctttcagaggttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggttagctttcagaggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggttagctttcagaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctggttagctttcagagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgctggttagctttcagag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgctggttagctttcaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attgctggttagctttcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattgctggttagctttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaattgctggttagctttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agaattgctggttagcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagaattgctggttagctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagaattgctggttagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctaagaattgctggttagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actaagaattgctggttag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gactaagaattgctggtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agactaagaattgctggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagactaagaattgctggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtagactaagaattgctgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtagactaagaattgctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtagactaagaattgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagtagactaagaattgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacagtagactaagaattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcacagtagactaagaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcacagtagactaagaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcacagtagactaagaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttcacagtagactaaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatttcacagtagactaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgatttcacagtagactaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgatttcacagtagacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcgatttcacagtagact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcgatttcacagtagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccatcgatttcacagtaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccatcgatttcacagtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acccatcgatttcacagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacccatcgatttcacagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agacccatcgatttcacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagacccatcgatttcaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagacccatcgatttcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccagacccatcgatttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttccagacccatcgatttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttccagacccatcgattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttccagacccatcgatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catttccagacccatcgat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccatttccagacccatcga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccatttccagacccatcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atccatttccagacccatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catccatttccagacccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccatccatttccagaccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccatccatttccagaccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtccatccatttccagacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtccatccatttccagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtccatccatttccaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagtccatccatttccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacagtccatccatttcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acacagtccatccatttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacacagtccatccatttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaacacagtccatccattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaacacagtccatccatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaaacacagtccatccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgaaacacagtccatcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgaaacacagtccatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctgaaacacagtccatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttctgaaacacagtccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttctgaaacacagtcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcttctgaaacacagtcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctcttctgaaacacagtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctcttctgaaacacagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtctcttctgaaacacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtctcttctgaaacaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caagtctcttctgaaacac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaagtctcttctgaaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcaagtctcttctgaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcaagtctcttctgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccatcaagtctcttctgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccatcaagtctcttctga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgccatcaagtctcttctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgccatcaagtctcttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgccatcaagtctcttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cactgccatcaagtctctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acactgccatcaagtctct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacactgccatcaagtctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctacactgccatcaagtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctacactgccatcaagtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctacactgccatcaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatctacactgccatcaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatctacactgccatcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaatctacactgccatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaaatctacactgccatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaaatctacactgccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgaaatctacactgcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttgaaatctacactgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcttgaaatctacactgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcttgaaatctacactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttcttgaaatctacact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttttcttgaaatctacac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttttcttgaaatctaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtttttcttgaaatctac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtttttcttgaaatcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagtttttcttgaaatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccagtttttcttgaaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atccagtttttcttgaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatccagtttttcttgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaatccagtttttcttgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaatccagtttttcttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaatccagtttttcttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attgaatccagtttttctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tattgaatccagtttttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atattgaatccagtttttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatattgaatccagttttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatattgaatccagtttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttatattgaatccagttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttatattgaatccagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctttatattgaatccagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctttatattgaatccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttctttatattgaatcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttctttatattgaatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccttctttatattgaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atccttctttatattgaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatccttctttatattgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatccttctttatattga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaatccttctttatattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaaatccttctttatatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccaaatccttctttatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtccaaatccttctttata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtccaaatccttctttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgtccaaatccttcttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgtccaaatccttcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agatgtccaaatccttctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagatgtccaaatccttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagatgtccaaatccttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacagatgtccaaatcctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agacagatgtccaaatcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagacagatgtccaaatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagacagatgtccaaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggagacagatgtccaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taggagacagatgtccaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaggagacagatgtccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtaggagacagatgtcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtaggagacagatgtcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagtaggagacagatgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccagtaggagacagatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgccagtaggagacagatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgccagtaggagacagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgccagtaggagacaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtgccagtaggagacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttgtgccagtaggagaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttgtgccagtaggagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgttgtgccagtaggaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgttgtgccagtaggag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctgttgtgccagtagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attctgttgtgccagtagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattctgttgtgccagtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaattctgttgtgccagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaattctgttgtgccagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaaattctgttgtgccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaaaattctgttgtgcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccaaaattctgttgtgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agccaaaattctgttgtgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagccaaaattctgttgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagccaaaattctgttgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccagccaaaattctgttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcccagccaaaattctgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcccagccaaaattctgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcccagccaaaattctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atttcccagccaaaattct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catttcccagccaaaattc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatttcccagccaaaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcatttcccagccaaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctcatttcccagccaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctcatttcccagccaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttctcatttcccagccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttctcatttcccagcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcttctcatttcccagcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatcttctcatttcccagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaatcttctcatttcccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaatcttctcatttccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgaatcttctcatttccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatgaatcttctcatttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatgaatcttctcatttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaatgaatcttctcattt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaatgaatcttctcatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcaaatgaatcttctcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcaaatgaatcttctca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatcaaatgaatcttctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttatcaaatgaatcttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcttatcaaatgaatcttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcttatcaaatgaatctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgcttatcaaatgaatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgcttatcaaatgaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgtgcttatcaaatgaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgtgcttatcaaatgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtgtgcttatcaaatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgtgtgcttatcaaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gactgtgtgcttatcaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agactgtgtgcttatcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagactgtgtgcttatcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcagactgtgtgcttatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcagactgtgtgcttatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggcagactgtgtgcttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggcagactgtgtgctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatggcagactgtgtgctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggatggcagactgtgtgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggatggcagactgtgtgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggatggcagactgtgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgggatggcagactgtgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgggatggcagactgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatgggatggcagactgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catatgggatggcagactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcatatgggatggcagact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcatatgggatggcagac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgcatatgggatggcaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatgcatatgggatggcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatgcatatgggatggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaatgcatatgggatggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttaatgcatatgggatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttaatgcatatgggatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcttaatgcatatgggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actcttaatgcatatggga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cactcttaatgcatatggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccactcttaatgcatatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccactcttaatgcatatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttccactcttaatgcatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttccactcttaatgcata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttccactcttaatgcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagttccactcttaatgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagttccactcttaatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccagttccactcttaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttccagttccactcttaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttccagttccactcttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttccagttccactctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcttccagttccactctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtcttccagttccactct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtcttccagttccactc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagtcttccagttccact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccagtcttccagttccac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttccagtcttccagttcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attccagtcttccagttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cattccagtcttccagttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccattccagtcttccagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccattccagtcttccagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgccattccagtcttccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgccattccagtcttcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgccattccagtcttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctgccattccagtcttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttctgccattccagtctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggttctgccattccagtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggttctgccattccagtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctggttctgccattccagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actggttctgccattccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactggttctgccattcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtactggttctgccattcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtactggttctgccattc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagtactggttctgccatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcagtactggttctgccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcagtactggttctgcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgcagtactggttctgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgcagtactggttctgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctgcagtactggttctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtctgcagtactggttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagtctgcagtactggttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atagtctgcagtactggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catagtctgcagtactggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcatagtctgcagtactgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcatagtctgcagtactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggcatagtctgcagtact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggcatagtctgcagtac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catggcatagtctgcagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acatggcatagtctgcagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacatggcatagtctgcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaacatggcatagtctgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaacatggcatagtctgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaacatggcatagtctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgaacatggcatagtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttgaacatggcatagtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accttgaacatggcatagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caccttgaacatggcatag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaccttgaacatggcata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccaccttgaacatggcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcccaccttgaacatggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcccaccttgaacatggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtcccaccttgaacatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggtcccaccttgaacatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggtcccaccttgaacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaggtcccaccttgaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaggtcccaccttgaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttcaggtcccaccttgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcttcaggtcccaccttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcttcaggtcccaccttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagcttcaggtcccacctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagcttcaggtcccacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcagcttcaggtcccacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtcagcttcaggtcccac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtcagcttcaggtccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgtcagcttcaggtccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttgtcagcttcaggtcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tacttgtcagcttcaggtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtacttgtcagcttcaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtacttgtcagcttcagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cggtacttgtcagcttcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcggtacttgtcagcttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcggtacttgtcagcttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggcggtacttgtcagctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taggcggtacttgtcagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaggcggtacttgtcagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttaggcggtacttgtcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttaggcggtacttgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgttaggcggtacttgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgttaggcggtacttgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatgttaggcggtacttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catatgttaggcggtactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcatatgttaggcggtact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcatatgttaggcggtac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggcatatgttaggcggta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taggcatatgttaggcggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaggcatatgttaggcgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtaggcatatgttaggcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtaggcatatgttaggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagtaggcatatgttagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgaagtaggcatatgttag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcgaagtaggcatatgtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcgaagtaggcatatgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagcgaagtaggcatatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagcgaagtaggcatatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accagcgaagtaggcatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caccagcgaagtaggcata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaccagcgaagtaggcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccaccagcgaagtaggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccccaccagcgaagtaggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccccaccagcgaagtagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atccccaccagcgaagtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catccccaccagcgaagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcatccccaccagcgaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcatccccaccagcgaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagcatccccaccagcgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagcatccccaccagcga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccagcatccccaccagcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctccagcatccccaccagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctccagcatccccaccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctccagcatccccacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catctccagcatccccacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcatctccagcatccccac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcatctccagcatcccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggcatctccagcatcccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggcatctccagcatccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaggcatctccagcatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaaggcatctccagcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaaggcatctccagcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcaaaggcatctccagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcaaaggcatctccagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccatcaaaggcatctccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccatcaaaggcatctcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agccatcaaaggcatctcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagccatcaaaggcatctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagccatcaaaggcatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaagccatcaaaggcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaagccatcaaaggcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcaaagccatcaaaggca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatcaaagccatcaaaggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatcaaagccatcaaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaatcaaagccatcaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaaatcaaagccatcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaaaatcaaagccatcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccaaaatcaaagccatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgccaaaatcaaagccatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcgccaaaatcaaagccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcgccaaaatcaaagcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcgccaaaatcaaagcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatcgccaaaatcaaagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcatcgccaaaatcaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatcatcgccaaaatcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggatcatcgccaaaatcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggatcatcgccaaaatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taggatcatcgccaaaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctaggatcatcgccaaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actaggatcatcgccaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cactaggatcatcgccaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcactaggatcatcgccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcactaggatcatcgcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtcactaggatcatcgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtcactaggatcatcgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgtcactaggatcatcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttgtcactaggatcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacttgtcactaggatcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaacttgtcactaggatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaacttgtcactaggatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaacttgtcactaggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaaaacttgtcactagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaaaaacttgtcactagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgaaaaacttgtcactag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgaaaaacttgtcacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgtgaaaaacttgtcact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgtgaaaaacttgtcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggatgtgaaaaacttgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggatgtgaaaaacttgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggatgtgaaaaacttgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgggatgtgaaaaacttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatgggatgtgaaaaactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatgggatgtgaaaaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attatgggatgtgaaaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cattatgggatgtgaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccattatgggatgtgaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccattatgggatgtgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgccattatgggatgtgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgccattatgggatgtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catgccattatgggatgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcatgccattatgggatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcatgccattatgggatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgcatgccattatgggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgcatgccattatggga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aactgcatgccattatggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaactgcatgccattatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaactgcatgccattatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgaactgcatgccattat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgaactgcatgccatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactgaactgcatgccatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtactgaactgcatgccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtactgaactgcatgcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggtactgaactgcatgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggtactgaactgcatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaggtactgaactgcatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccaggtactgaactgcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcccaggtactgaactgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcccaggtactgaactgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtcccaggtactgaactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtcccaggtactgaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attgtcccaggtactgaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cattgtcccaggtactgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcattgtcccaggtactga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcattgtcccaggtactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtcattgtcccaggtact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtcattgtcccaggtac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attgtcattgtcccaggta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cattgtcattgtcccaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcattgtcattgtcccagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcattgtcattgtcccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcattgtcattgtccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatcattgtcattgtccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttatcattgtcattgtcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttatcattgtcattgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacttatcattgtcattgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaacttatcattgtcattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaacttatcattgtcatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaaacttatcattgtcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaaacttatcattgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttcaaacttatcattgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttcaaacttatcattgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccttcaaacttatcattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgccttcaaacttatcatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgccttcaaacttatcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttgccttcaaacttatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttgccttcaaacttatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagttgccttcaaacttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acagttgccttcaaactta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacagttgccttcaaactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcacagttgccttcaaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcacagttgccttcaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagcacagttgccttcaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagcacagttgccttcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcagcacagttgccttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttcagcacagttgccttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttcagcacagttgcctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgttcagcacagttgcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctgttcagcacagttgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctgttcagcacagttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcctgttcagcacagttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcctgttcagcacagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccatcctgttcagcacagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccatcctgttcagcacag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atccatcctgttcagcaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatccatcctgttcagcac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agatccatcctgttcagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagatccatcctgttcagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagatccatcctgttcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accagatccatcctgttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaccagatccatcctgttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaccagatccatcctgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaaccagatccatcctgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accaaccagatccatcctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caccaaccagatccatcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaccaaccagatccatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccaccaaccagatccatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atccaccaaccagatccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catccaccaaccagatcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatccaccaaccagatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcatccaccaaccagatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttcatccaccaaccagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttcatccaccaaccaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgttcatccaccaaccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttgttcatccaccaacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acttgttcatccaccaacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cacttgttcatccaccaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acacttgttcatccaccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacacttgttcatccacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacacttgttcatccacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgacacttgttcatccac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgtgacacttgttcatcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcgtgacacttgttcatcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcgtgacacttgttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagcgtgacacttgttcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagcgtgacacttgttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccagcgtgacacttgttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggccagcgtgacacttgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggccagcgtgacacttgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggccagcgtgacacttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatggccagcgtgacactt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agatggccagcgtgacact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagatggccagcgtgacac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgagatggccagcgtgaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgagatggccagcgtgac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attgagatggccagcgtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cattgagatggccagcgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccattgagatggccagcgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccattgagatggccagcg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctccattgagatggccagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actccattgagatggccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aactccattgagatggcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaactccattgagatggcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaactccattgagatggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataaactccattgagatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aataaactccattgagatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taataaactccattgagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaataaactccattgaga 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct ggtaataaactccattgag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggtaataaactccattga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggtaataaactccattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttggtaataaactccatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttggtaataaactccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accttggtaataaactcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caccttggtaataaactcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaccttggtaataaactc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccaccttggtaataaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgccaccttggtaataaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgccaccttggtaataaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtgccaccttggtaataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtgccaccttggtaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taagtgccaccttggtaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaagtgccaccttggtaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtaagtgccaccttggta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagtaagtgccaccttggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgagtaagtgccaccttgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgagtaagtgccaccttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgagtaagtgccacctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttgagtaagtgccacct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttttgagtaagtgccacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcttttgagtaagtgccac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcttttgagtaagtgcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgcttttgagtaagtgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgcttttgagtaagtgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agatgcttttgagtaagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagatgcttttgagtaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtagatgcttttgagtaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtagatgcttttgagtaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagtagatgcttttgagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagtagatgcttttgagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggagtagatgcttttgag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taggagtagatgcttttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaggagtagatgcttttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attaggagtagatgctttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cattaggagtagatgcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccattaggagtagatgctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accattaggagtagatgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaccattaggagtagatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaccattaggagtagatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataaccattaggagtagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cataaccattaggagtaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcataaccattaggagtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcataaccattaggagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcataaccattaggagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatcataaccattaggag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attatcataaccattagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cattatcataaccattagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccattatcataaccattag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gccattatcataaccatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgccattatcataaccatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgccattatcataaccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatgccattatcataacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taatgccattatcataacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataatgccattatcataac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aataatgccattatcataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaataatgccattatcata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaataatgccattatcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaaataatgccattatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccaaataatgccattatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcccaaataatgccattat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggcccaaataatgccatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggcccaaataatgccatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtggcccaaataatgccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtggcccaaataatgcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtggcccaaataatgcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caagtggcccaaataatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaagtggcccaaataatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccaagtggcccaaataat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttccaagtggcccaaataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttccaagtggcccaaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttccaagtggcccaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttttccaagtggcccaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggttttccaagtggcccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggttttccaagtggccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgggttttccaagtggccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccgggttttccaagtggcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accgggttttccaagtggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caccgggttttccaagtgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaccgggttttccaagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accaccgggttttccaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taccaccgggttttccaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataccaccgggttttccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aataccaccgggttttcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaataccaccgggttttcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaataccaccgggttttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggaataccaccgggtttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggaataccaccgggttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catggaataccaccgggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatggaataccaccgggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcatggaataccaccggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttcatggaataccaccgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttcatggaataccaccg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcttcatggaataccacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcttcatggaataccac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttcttcatggaatacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttttcttcatggaatacc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggttttcttcatggaatac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggttttcttcatggaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtggttttcttcatggaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtggttttcttcatggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagtggttttcttcatgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atagtggttttcttcatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catagtggttttcttcatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatagtggttttcttcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcatagtggttttcttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttcatagtggttttcttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttcatagtggttttctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcttcatagtggttttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcttcatagtggttttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatcttcatagtggtttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attatcttcatagtggttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gattatcttcatagtggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggattatcttcatagtggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggattatcttcatagtgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgggattatcttcatagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgggattatcttcatagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatgggattatcttcatag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaatgggattatcttcata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaatgggattatcttcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaatgggattatcttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttgaatgggattatcttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttgaatgggattatctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgttgaatgggattatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgttgaatgggattatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctgttgaatgggattat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtctgttgaatgggatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagtctgttgaatgggatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgagtctgttgaatgggat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgagtctgttgaatggga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtgagtctgttgaatggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtgagtctgttgaatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attgtgagtctgttgaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattgtgagtctgttgaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caattgtgagtctgttgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaattgtgagtctgttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccaattgtgagtctgttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctccaattgtgagtctgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctccaattgtgagtctgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttctccaattgtgagtctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttctccaattgtgagtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccttctccaattgtgagtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccttctccaattgtgagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtccttctccaattgtgag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtccttctccaattgtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtccttctccaattgtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctgtccttctccaattgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgctgtccttctccaattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgctgtccttctccaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttgctgtccttctccaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttgctgtccttctccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgttgctgtccttctcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtgttgctgtccttctcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggtgttgctgtccttctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtggtgttgctgtccttct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtggtgttgctgtccttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggtggtgttgctgtcctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caggtggtgttgctgtcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaggtggtgttgctgtcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccaggtggtgttgctgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccccaggtggtgttgctgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cccccaggtggtgttgctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccccccaggtggtgttgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccccccaggtggtgttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctccccccaggtggtgttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctccccccaggtggtgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggctccccccaggtggtgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggctccccccaggtggtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttggctccccccaggtggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttggctccccccaggtgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttggctccccccaggtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtttggctccccccaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgtttggctccccccagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctgtttggctccccccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcctgtttggctcccccca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcctgtttggctcccccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagcctgtttggctccccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccagcctgtttggctcccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccagcctgtttggctccc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctccagcctgtttggctcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctccagcctgtttggctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtctccagcctgtttggct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cgtctccagcctgtttggc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acgtctccagcctgtttgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacgtctccagcctgtttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaacgtctccagcctgttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaacgtctccagcctgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaaacgtctccagcctgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttaaacgtctccagcctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttaaacgtctccagcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttttaaacgtctccagcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttttaaacgtctccagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcttttaaacgtctccag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtcttttaaacgtctcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cggtcttttaaacgtctcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acggtcttttaaacgtctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacggtcttttaaacgtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaacggtcttttaaacgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaacggtcttttaaacgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaaacggtcttttaaacg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaaacggtcttttaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgaaacggtcttttaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttgaaacggtcttttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttttgaaacggtctttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttttgaaacggtctttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcttttgaaacggtcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctcttttgaaacggtctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctcttttgaaacggtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatctcttttgaaacggtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatctcttttgaaacggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaatctcttttgaaacgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtaaatctcttttgaaacg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtaaatctcttttgaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtaaatctcttttgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagtaaatctcttttgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaagtaaatctcttttga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaagtaaatctcttttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaaagtaaatctctttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaaaaagtaaatctcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaaaaaagtaaatctctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttaaaaaagtaaatctct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttaaaaaagtaaatctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cctttaaaaaagtaaatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcctttaaaaaagtaaatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcctttaaaaaagtaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtcctttaaaaaagtaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtcctttaaaaaagtaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaagtcctttaaaaaagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaagtcctttaaaaaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataaagtcctttaaaaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gataaagtcctttaaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agataaagtcctttaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagataaagtcctttaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagataaagtcctttaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcagataaagtcctttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttcagataaagtccttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttcagataaagtccttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgttcagataaagtcctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctgttcagataaagtcct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctctgttcagataaagtcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctctgttcagataaagtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctctctgttcagataaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctctctgttcagataaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atctctctgttcagataaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatctctctgttcagataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atatctctctgttcagata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatatctctctgttcagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatatctctctgttcaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attatatctctctgttcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tattatatctctctgttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atattatatctctctgttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatattatatctctctgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatattatatctctctgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaatattatatctctctg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaatattatatctctct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaaaatattatatctctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaaaaatattatatctct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggaaaaatattatatctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taggaaaaatattatatct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataggaaaaatattatatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aataggaaaaatattatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caataggaaaaatattata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccaataggaaaaatattat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccaataggaaaaatatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtccaataggaaaaatatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtccaataggaaaaatat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgtccaataggaaaaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attgtccaataggaaaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cattgtccaataggaaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ccattgtccaataggaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tccattgtccaataggaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtccattgtccaataggaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtccattgtccaatagga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtccattgtccaatagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caagtccattgtccaatag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcaagtccattgtccaata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcaagtccattgtccaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgcaagtccattgtccaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgcaagtccattgtcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctttgcaagtccattgtcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctttgcaagtccattgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agctttgcaagtccattgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagctttgcaagtccattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagctttgcaagtccatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaagctttgcaagtccat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgaagctttgcaagtcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtgaagctttgcaagtcc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aagtgaagctttgcaagtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagtgaagctttgcaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaagtgaagctttgcaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgaagtgaagctttgcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatgaagtgaagctttgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatgaagtgaagctttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaatgaagtgaagctttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaaatgaagtgaagcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaaaatgaagtgaagctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttaaaatgaagtgaagct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttaaaatgaagtgaagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcttaaaatgaagtgaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gctcttaaaatgaagtgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgctcttaaaatgaagtga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgctcttaaaatgaagtg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttgctcttaaaatgaagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttgctcttaaaatgaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttttgctcttaaaatgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttttgctcttaaaatga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcttttgctcttaaaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtcttttgctcttaaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gggtcttttgctcttaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggggtcttttgctcttaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggggtcttttgctcttaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggggtcttttgctctta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catggggtcttttgctctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acatggggtcttttgctct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacatggggtcttttgctc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caacatggggtcttttgct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaacatggggtcttttgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttcaacatggggtcttttg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttcaacatggggtctttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttttcaacatggggtcttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttttcaacatggggtctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agttttcaacatggggtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gagttttcaacatggggtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggagttttcaacatggggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggagttttcaacatgggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atggagttttcaacatggg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatggagttttcaacatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatggagttttcaacatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gttatggagttttcaacat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgttatggagttttcaaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctgttatggagttttcaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct actgttatggagttttcaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aactgttatggagttttca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaactgttatggagttttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaactgttatggagtttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaaactgttatggagttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataaaactgttatggagtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cataaaactgttatggagt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcataaaactgttatggag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agcataaaactgttatgga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cagcataaaactgttatgg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcagcataaaactgttatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcagcataaaactgttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catcagcataaaactgtta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcatcagcataaaactgtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atcatcagcataaaactgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tatcatcagcataaaactg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttatcatcagcataaaact 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attatcatcagcataaaac 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aattatcatcagcataaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaattatcatcagcataaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taaattatcatcagcataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ataaattatcatcagcata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gataaattatcatcagcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agataaattatcatcagca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagataaattatcatcagc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtagataaattatcatcag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtagataaattatcatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgtagataaattatcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct catgtagataaattatcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gcatgtagataaattatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgcatgtagataaattatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct atgcatgtagataaattat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aatgcatgtagataaatta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaatgcatgtagataaatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaatgcatgtagataaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaaatgcatgtagataaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttgaaatgcatgtagataa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct attgaaatgcatgtagata 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tattgaaatgcatgtagat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttattgaaatgcatgtaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tttattgaaatgcatgtag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtttattgaaatgcatgta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggtttattgaaatgcatgt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggtttattgaaatgcatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaggtttattgaaatgcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaggtttattgaaatgca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaaaggtttattgaaatgc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct caaaaggtttattgaaatg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct acaaaaggtttattgaaat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aacaaaaggtttattgaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aaacaaaaggtttattgaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaaacaaaaggtttattga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ggaaacaaaaggtttattg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct aggaaacaaaaggtttatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taggaaacaaaaggtttat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ttaggaaacaaaaggttta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct cttaggaaacaaaaggttt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttaggaaacaaaaggtt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtcttaggaaacaaaaggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agtcttaggaaacaaaagg 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagtcttaggaaacaaaag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctagtcttaggaaacaaaa 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tctagtcttaggaaacaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside cagacatcatgagttggtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside ccggaatttaattctctaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside ctctacttctatgctcttatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside ctgcatcttagatgaaagatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tgcatcttagatgaaagaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside gcatcttagatgaaagatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tcttagatgaaagattcgatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside ttagatgaaagattcggtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tagatgaaagattcggtaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside agatgaaagattcggtagatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tgaaagattcggtagttaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside gaaagattcggtagttatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside gattcggtagttattgtcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside cggtagttattgtccaacatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gtagttattgtccaactaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside agttattgtccaactaccatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside gatttcctgtctacttatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside atttcctgtctacttatcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside agtagacaaggatctacaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside ggatctacagtctttggaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside atctacagtctttggaagatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage ggaagacatcttacatcaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside aagacatcttacatcaagatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage cagctgataaaagcaatcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside tgataaaagcaatccaacatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside aatcctgatgaatcatcaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside tgatgaatcatcaaaaccatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gtccaggaaaatgttagaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside ccatgatatcactgggaaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage aagattgtcaagacattgatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside agagcgggctttactttaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside taaacctctgaaagctaaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside tcaagaaaaactggattcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside agaaaaactggattcaatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside ggaaatgagaagattcatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside gaagattcatttgataagatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside agattcatttgataagcaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside cattaagagtggaactggatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside acaatgacaatgataagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside taagtttgaaggcaactgatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside ctcaatggagtttattacatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside tcaatggagtttattaccatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside agtttattaccaaggtggatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside aaagcatctactcctaatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside aagcatctactcctaatgatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside atctactcctaatggttaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside tctactcctaatggttatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside ctactcctaatggttatgatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside ctcctaatggttatgataatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside cctaatggttatgataatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside ttatttgggccacttggaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside accactatgaagataatcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside taccaactcatgatgtctgtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside ttagagaattaaattccggtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside taagagcatagaagtagagtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tctttcatctaagatgcagtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside ttctttcatctaagatgcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tatctttcatctaagatgctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage tcgaatctttcatctaagatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside taccgaatctttcatctaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside ttaccgaatctttcatctatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tctaccgaatctttcatcttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tactaccgaatctttcatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside ttaactaccgaatctttcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tataactaccgaatctttctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tgacaataactaccgaatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tgttggacaataactaccgtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside ttagttggacaataactactt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tggtagttggacaataacttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tataagtagacaggaaatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tgataagtagacaggaaattt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside ttgtagatccttgtctacttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside ttccaaagactgtagatcctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tcttccaaagactgtagattt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside ttgatgtaagatgtcttcctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tcttgatgtaagatgtctttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tgattgcttttatcagctgtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tgttggattgcttttatcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside ttgatgattcatcaggatttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tggttttgatgattcatcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside ttctaacattttcctggactt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tttcccagtgatatcatggtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tcaatgtcttgacaatctttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside ttaaagtaaagcccgctcttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tttagctttcagaggtttatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tgaatccagtttttcttgatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tattgaatccagtttttcttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tatgaatcttctcatttcctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tcttatcaaatgaatcttctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside ttgcttatcaaatgaatcttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tccagttccactcttaatgtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tacttatcattgtcattgttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tcagttgccttcaaacttatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tgtaataaactccattgagtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tggtaataaactccattgatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tccaccttggtaataaacttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tattaggagtagatgcttttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tcattaggagtagatgctttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside ttaaccattaggagtagattt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tataaccattaggagtagatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tcataaccattaggagtagtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside ttatcataaccattaggagtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tattatcataaccattaggtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside ttccaagtggcccaaataatt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tgattatcttcatagtggtstst 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc#1 modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 1 mod_base OTHER note GalNAc#1 note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside ggaaatgagaagattcatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc#1 modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside gaagattcatttgataagatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc#1 modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside taagtttgaaggcaactgatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tactaccgaatctttcatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tatgaatcttctcatttcctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tcttatcaaatgaatcttctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside tcagttgccttcaaacttatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc#1 note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc#1 note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc#1 gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc#1 note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc#1 note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc#1 modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note GalNAc#1 note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2^3 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 19^20 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 20^21 mod_base OTHER note 2-fluoro-modified nucleoside gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc#1 modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside ggaaatgagaagattcatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc#1 modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside ggaaatgagaagattcatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc#1 note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside ggaaatgagaagattcatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc#1 modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside ggaaatgagaagattcatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc#1 note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside ggaaatgagaagattcatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc#1 note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside ggaaatgagaagattcatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc#1 note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside ggaaatgagaagattcatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc#1 modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside ggaaatgagaagattcatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc#1 modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside ggaaatgagaagattcatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc#1 note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside ggaaatgagaagattcatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc#1 modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside ggaaatgagaagattcatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc#1 note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside ggaaatgagaagattcatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc#1 note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside ggaaatgagaagattcatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc#1 note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside ggaaatgagaagattcatatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc#1 note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside taagtttgaaggcaactgatt 1760 RNA PAT source 1..1760 mol_type other RNA organism synthetic construct aaaaaggaggagcttcaacctgtgtgcaaaatctgggaacctgacagtataggttgggggccaggatgaggaaaaaggaacgggaaagacctgcccacccttctggtaaggaggccccgtgatcagctccagccatttgcagtcctggctatcccaggagcttacataaagggacaattggagcctgagaggtgacagtgctgacactacaaggctcggagctccgggcactcagacatcatgagttggtccttgcacccccggaatttaattctctacttctatgctcttttatttctctcttcaacatgtgtagcatatgttgctaccagagacaactgctgcatcttagatgaaagattcggtagttattgtccaactacctgtggcattgcagatttcctgtctacttatcaaaccaaagtagacaaggatctacagtctttggaagacatcttacatcaagttgaaaacaaaacatcagaagtcaaacagctgataaaagcaatccaactcacttataatcctgatgaatcatcaaaaccaaatatgatagacgctgctactttgaagtccaggaaaatgttagaagaaattatgaaatatgaagcatcgattttaacacatgactcaagtattcgatatttgcaggaaatatataattcaaataatcaaaagattgttaacctgaaagagaaggtagcccagcttgaagcacagtgccaggaaccttgcaaagacacggtgcaaatccatgatatcactgggaaagattgtcaagacattgccaataagggagctaaacagagcgggctttactttattaaacctctgaaagctaaccagcaattcttagtctactgtgaaatcgatgggtctggaaatggatggactgtgtttcagaagagacttgatggcagtgtagatttcaagaaaaactggattcaatataaagaaggatttggacatctgtctcctactggcacaacagaattttggctgggaaatgagaagattcatttgataagcacacagtctgccatcccatatgcattaagagtggaactggaagactggaatggcagaaccagtactgcagactatgccatgttcaaggtgggacctgaagctgacaagtaccgcctaacatatgcctacttcgctggtggggatgctggagatgcctttgatggctttgattttggcgatgatcctagtgacaagtttttcacatcccataatggcatgcagttcagtacctgggacaatgacaatgataagtttgaaggcaactgtgctgaacaggatggatctggttggtggatgaacaagtgtcacgctggccatctcaatggagtttattaccaaggtggcacttactcaaaagcatctactcctaatggttatgataatggcattatttgggccacttggaaaacccggtggtattccatgaagaaaaccactatgaagataatcccattcaacagactcacaattggagaaggacagcaacaccacctggggggagccaaacaggctggagacgtttaaaagaccgtttcaaaagagatttacttttttaaaggactttatctgaacagagagatataatatttttcctattggacaatggacttgcaaagcttcacttcattttaagagcaaaagaccccatgttgaaaactccataacagttttatgctgatgataatttatctacatgcatttcaataaaccttttgtttcctaagactaga 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note GalNAc note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 3^4 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gaagattcatttgataagatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 15 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note any deoxynucleotide modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 17 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gaagattcatttgataagatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 8 mod_base OTHER note any deoxynucleotide modified_base 3 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 15 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gaagattcatttgataagatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage ctcaatggagtttattacatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note GalNAc note 2-O-methyl modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage tcaatggagtttattaccatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gaagattcatttgataagatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage agacatcatgagttggtcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage agactggaatggcagaacatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage tgacaagtttttcacatcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage tgacaagtttttcacatcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gacaagtttttcacatccatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gagtttattaccaaggtgatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note any deoxynucleotide modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage taccaaggtggcacttacatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage accaaggtggcacttactatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage aaggtggcacttactcaaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage aggtggcacttactcaaaatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 5 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage gatgaaagattcggtagtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage tgacaagtttttcacatcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 13 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage tgacaagtttttcacatcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage tgacaagtttttcacatcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage tgacaagtttttcacatcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage tgacaagtttttcacatcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note GalNAc note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage tgacaagtttttcacatcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside note GalNAc modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 14 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 16 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 18 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage tgacaagtttttcacatcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tactaccgaatctttcatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tcttatcaaatgaatcttctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tactaccgaatctttcatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tactaccgaatctttcatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tcttatcaaatgaatcttctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tcttatcaaatgaatcttctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tgtaataaactccattgagtt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tggtaataaactccattgatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tactaccgaatctttcatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tactaccgaatctttcatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tcttatcaaatgaatcttctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tactaccgaatctttcatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tactaccgaatctttcatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tactaccgaatctttcatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tgaccaactcatgatgtcttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tgttctgccattccagtcttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tgatgtgaaaaacttgtcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside tgatgtgaaaaacttgtcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tggatgtgaaaaacttgtctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tcaccttggtaataaactctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tgtaagtgccaccttggtatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tagtaagtgccaccttggttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tttgagtaagtgccacctttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside ttttgagtaagtgccaccttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 4 mod_base OTHER note any deoxynucleotide modified_base 6 mod_base OTHER note any deoxynucleotide modified_base 13 mod_base OTHER note any deoxynucleotide modified_base 16 mod_base OTHER note any deoxynucleotide modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tactaccgaatctttcatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 4 mod_base OTHER note any deoxynucleotide modified_base 6 mod_base OTHER note any deoxynucleotide modified_base 12 mod_base OTHER note any deoxynucleotide modified_base 14 mod_base OTHER note any deoxynucleotide modified_base 16 mod_base OTHER note any deoxynucleotide modified_base 18 mod_base OTHER note any deoxynucleotide modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 11 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tactaccgaatctttcatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tactaccgaatctttcatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note any deoxynucleotide modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tactaccgaatctttcatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 1 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 4 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tactaccgaatctttcatctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tgatgtgaaaaacttgtcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tgatgtgaaaaacttgtcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tgatgtgaaaaacttgtcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tgatgtgaaaaacttgtcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tgatgtgaaaaacttgtcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 8 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tgatgtgaaaaacttgtcatt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1^2 mod_base OTHER note phosphorothioate linkage modified_base 2^3 mod_base OTHER note phosphorothioate linkage modified_base 19^20 mod_base OTHER note phosphorothioate linkage modified_base 20^21 mod_base OTHER note phosphorothioate linkage modified_base 2 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 4 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 6 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 8 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 10 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 12 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 14 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 16 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 18 mod_base OTHER note 2-fluoro-modified nucleoside modified_base 1 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 3 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 5 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 7 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 9 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 11 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 13 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 15 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 17 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 19 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 20 mod_base OTHER note 2-O-methyl modified nucleoside modified_base 21 mod_base OTHER note 2-O-methyl modified nucleoside tgatgtgaaaaacttgtcatt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacaagtttttcacatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacaagtttttcacatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacaagtttttcacatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacaagtttttcacatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taccaaggtggcacttaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacaagtttttcacatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacaagtttttcacatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagattcatttgataaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct agacatcatgagttggtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gacaagtttttcacatcca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct taccaaggtggcacttaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct accaaggtggcacttacta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacaagtttttcacatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacaagtttttcacatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gaagattcatttgataaga 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gatgaaagattcggtagta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct ctcaatggagtttattaca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgacaagtttttcacatca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcaatggagtttattacca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgtgaaaaacttgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgtgaaaaacttgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgtgaaaaacttgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgtgaaaaacttgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtaagtgccaccttggta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgtgaaaaacttgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgtgaaaaacttgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttatcaaatgaatcttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgaccaactcatgatgtct 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggatgtgaaaaacttgtc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtaagtgccaccttggta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tagtaagtgccaccttggt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgtgaaaaacttgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgtgaaaaacttgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tcttatcaaatgaatcttc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tactaccgaatctttcatc 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgtaataaactccattgag 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tgatgtgaaaaacttgtca 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct tggtaataaactccattga 000 000