P122507 Denka Life Innovation Research Pte Ltd METHODS FOR THE DETECTION AND IDENTIFICATION OF FUNGAL SPECIES 37 23 DNA PAT misc_feature 1..23 note oligonucleotide primer sequence source 1..23 mol_type other DNA organism synthetic construct caacaacggatctcttggttctc 25 DNA PAT misc_feature 1..25 note Oligonucleotide primer sequence source 1..25 mol_type other DNA organism synthetic construct aggtcaaagtttgaagatatacgtg 26 DNA PAT misc_feature 1..26 note Oligonucleotide primer sequence source 1..26 mol_type other DNA organism synthetic construct ctacctgatttgaggtcaaagttatg 22 DNA PAT misc_feature 1..22 note Oligonucleotide primer sequence source 1..22 mol_type other DNA organism synthetic construct cctgatttgaggtcgaatttgg 18 DNA PAT misc_feature 1..18 note Oligonucleotide primer sequence source 1..18 mol_type other DNA organism synthetic construct gtctcgcaacactcgcty 19 DNA PAT misc_feature 1..19 note Oligonucleotide primer sequence source 1..19 mol_type other DNA organism synthetic construct atatcccgccacaccattc 23 DNA PAT misc_feature 1..23 note Oligonucleotide primer sequence source 1..23 mol_type other DNA organism synthetic construct ttcgtgcaagctgtaattttgtg 19 DNA PAT misc_feature 1..19 note Oligonucleotide primer sequence source 1..19 mol_type other DNA organism synthetic construct agacatctctggggaggac 22 DNA PAT misc_feature 1..22 note Oligonucleotide primer sequence source 1..22 mol_type other DNA organism synthetic construct cccccaacgaacaaaagaatag 21 DNA PAT misc_feature 1..21 note Oligonucleotide primer sequence source 1..21 mol_type other DNA organism synthetic construct tgactctaggaggggtctgag 22 DNA PAT misc_feature 1..22 note Oligonucleotide primer sequence source 1..22 mol_type other DNA organism synthetic construct gaactttcaagtcctccgcaac 25 DNA PAT misc_feature 1..25 note Oligonucleotide primer sequence source 1..25 mol_type other DNA organism synthetic construct tccaaacttatccatwcacattcac 24 DNA PAT misc_feature 1..24 note Oligonucleotide primer sequence source 1..24 mol_type other DNA organism synthetic construct aaatgcttatctatcygtccaacc 19 DNA PAT misc_feature 1..19 note Oligonucleotide primer sequence source 1..19 mol_type other DNA organism synthetic construct scaggttatcgcaagttgg 18 DNA PAT misc_feature 1..18 note Oligonucleotide primer sequence source 1..18 mol_type other DNA organism synthetic construct tgyccatcccctcttgac 17 DNA PAT misc_feature 1..17 note Oligonucleotide primer sequence source 1..17 mol_type other DNA organism synthetic construct gccttccgagttccctg 18 DNA PAT misc_feature 1..18 note Oligonucleotide primer sequence source 1..18 mol_type other DNA organism synthetic construct ccaagcccaagtctggtc 19 DNA PAT misc_feature 1..19 note Oligonucleotide primer sequence source 1..19 mol_type other DNA organism synthetic construct gacttggaggaacggtctg 24 DNA PAT misc_feature 1..24 note Oligonucleotide primer sequence source 1..24 mol_type other DNA organism synthetic construct gatccagtcaaaaaataacgtgga 25 DNA PAT misc_feature 1..25 note Oligonucleotide primer sequence source 1..25 mol_type other DNA organism synthetic construct atatgattgatgctcctgaaccttc 26 DNA PAT misc_feature 1..26 note Oligonucleotide primer sequence source 1..26 mol_type other DNA organism synthetic construct catttgcatggaaagctcttaataag 25 DNA PAT misc_feature 1..25 note Oligonucleotide primer sequence source 1..25 mol_type other DNA organism synthetic construct tggttctattktgttggtttctagg 22 DNA PAT misc_feature 1..22 note Oligonucleotide primer sequence source 1..22 mol_type other DNA organism synthetic construct agactacgacggtatctgatca 26 DNA PAT misc_feature 1..26 note Oligonucleotide probe sequence source 1..26 mol_type other DNA organism synthetic construct tttttctaaccaaaaacattgcttgc 25 DNA PAT misc_feature 1..25 note Oligonucleotide probe sequence source 1..25 mol_type other DNA organism synthetic construct ttttttaggtttgtttgaaagaatt 25 DNA PAT misc_feature 1..25 note Oligonucleotide probe sequence source 1..25 mol_type other DNA organism synthetic construct tttttttttgcttgaaagaaaggcg 25 DNA PAT misc_feature 1..25 note Oligonucleotide probe sequence source 1..25 mol_type other DNA organism synthetic construct ttttttttcgagcgaactagacttt 25 DNA PAT misc_feature 1..25 note Oligonucleotide probe sequence source 1..25 mol_type other DNA organism synthetic construct ttttttttgtcgacctctcaatgta 25 DNA PAT misc_feature 1..25 note Oligonucleotide probe sequence source 1..25 mol_type other DNA organism synthetic construct tttttttgatgtcttctcaccaatc 25 DNA PAT misc_feature 1..25 note Oligonucleotide probe sequence source 1..25 mol_type other DNA organism synthetic construct ttttttctctctattccaaaggagg 25 DNA PAT misc_feature 1..25 note Oligonucleotide probe sequence source 1..25 mol_type other DNA organism synthetic construct tttttttatcattacgatggtccta 25 DNA PAT misc_feature 1..25 note Oligonucleotide probe sequence source 1..25 mol_type other DNA organism synthetic construct tttttgggtcattgatattctgtaa 25 DNA PAT misc_feature 1..25 note Oligonucleotide probe sequence source 1..25 mol_type other DNA organism synthetic construct ttttttttcagtagtatgcccagtg 25 DNA PAT misc_feature 1..25 note Oligonucleotide probe sequence source 1..25 mol_type other DNA organism synthetic construct tttttttttacgcatcttagccaag 25 DNA PAT misc_feature 1..25 note Oligonucleotide probe sequence source 1..25 mol_type other DNA organism synthetic construct tttttttttgagtgatcgaaagatg 25 DNA PAT misc_feature 1..25 note Oligonucleotide probe sequence source 1..25 mol_type other DNA organism synthetic construct ttttttttaagactcagacaaacag 25 DNA PAT misc_feature 1..25 note Oligonucleotide probe sequence source 1..25 mol_type other DNA organism synthetic construct tttttccagaagtatgaaatatttg