OPA22119-PCT KR KR 10-2021-0125842 2021-09-23 CJ CheilJedang Corporation STRAIN FOR PRODUCING HIGH CONCENTRATION L-GLUTAMIC ACID AND METHOD FOR PRODUCING L-GLUTAMIC ACID USING THE SAME 38 245 AA PAT REGION 1..245 note BBD29_13140 source 1..245 mol_type protein organism Corynebacterium glutamicum MNQDLSHEDSGDGNSVDRGQILLAVLIGLALIASVIMLLANSDGAMKIALLAALWAAIIGFFLVYRSRKQVEAAAREKETLEYAHQSELNRLEAELVQEKMEISESRRARDQETLEEIKLQLEEMRTQLSELSGREWGYEPTMLRAEARRILELESQQLSQQFQAPQPEVPEPVAVPEPTPEPAPVPEPEPVEVAVEAEEEPAPGRRRRRHAAPEEAGGRRRKDERQGGLSVADLLAAARKKENN 738 DNA PAT misc_feature 1..738 note BBD29_13140 source 1..738 mol_type genomic DNA organism Corynebacterium glutamicum atgaatcaagacctgtcacacgaggattccggcgacggcaattctgtcgaccgtggacagattctgctagcagtactcattggacttgccctgattgccagcgtcatcatgctgctggccaacagtgacggcgccatgaaaatagcacttcttgcagcgctgtgggcggcaatcatcggattcttccttgtttatcggtcccgcaaacaagtcgaagctgctgcgcgggagaaggaaaccctcgaatacgcacaccaatctgaactcaaccgactagaagctgaactcgtccaagaaaaaatggagatttctgaatcccgtcgtgcacgcgatcaggaaacccttgaggaaatcaaacttcaactggaggaaatgcgcacccagctgtctgagctttctggccgtgaatggggctatgagccaaccatgctgcgtgccgaagcccgacgaatccttgagttggaatcccagcagctttcccagcagttccaggcaccgcagccagaagtcccggagcctgttgcagttccagagccaacgccggaacctgcaccggtgccggaacctgagccagttgaagttgctgtcgaagctgaggaagaaccagcaccaggtcgcagaaggcgtaggcacgcggctcccgaagaagctggcggacgccgacgcaaagatgaacgccaaggcggtttgagcgtggctgatcttctggcagcagcaaggaaaaaggaaaacaactaa 38 DNA PAT misc_feature 1..38 note 1F source 1..38 mol_type other DNA organism synthetic construct ttcgagctcggtaccccgatctactcaaccccaccgtg 38 DNA PAT misc_feature 1..38 note 2R source 1..38 mol_type other DNA organism synthetic construct acaggtcttgattcacgaattccaatctagctgatcgc 38 DNA PAT misc_feature 1..38 note 3F source 1..38 mol_type other DNA organism synthetic construct agctagattggaattcgtgaatcaagacctgtcacacg 34 DNA PAT misc_feature 1..34 note 4R source 1..34 mol_type other DNA organism synthetic construct actctagaggatccccgatcagccacgctcaaac 38 DNA PAT misc_feature 1..38 note 5R source 1..38 mol_type other DNA organism synthetic construct acaggtcttgattcaagaattccaatctagctgatcgc 38 DNA PAT misc_feature 1..38 note 6F source 1..38 mol_type other DNA organism synthetic construct agctagattggaattcttgaatcaagacctgtcacacg 38 DNA PAT misc_feature 1..38 note 7F source 1..38 mol_type other DNA organism synthetic construct tgaattcgagctcggtacccttgaacggaattgggtgg 38 DNA PAT misc_feature 1..38 note 8R source 1..38 mol_type other DNA organism synthetic construct cccaggtggcatcggtaccttcacccagcgccacgcag 39 DNA PAT misc_feature 1..39 note 9F source 1..39 mol_type other DNA organism synthetic construct cgctgggtgaaggtaccgatgccacctgggttggtcaag 38 DNA PAT misc_feature 1..38 note 10R source 1..38 mol_type other DNA organism synthetic construct gtcgactctagaggatccccggacaaggaatggagaga 18 DNA PAT misc_feature 1..18 note 11F source 1..18 mol_type other DNA organism synthetic construct cttaccgttgttgccctt 19 DNA PAT misc_feature 1..19 note 12R source 1..19 mol_type other DNA organism synthetic construct ctccttcacccacatcatt 16 DNA PAT misc_feature 1..16 note 13F source 1..16 mol_type other DNA organism synthetic construct gatcgctacgcgctgc 18 DNA PAT misc_feature 1..18 note 14R source 1..18 mol_type other DNA organism synthetic construct gcgaggagcctgcattag 38 DNA PAT misc_feature 1..38 note 15F source 1..38 mol_type other DNA organism synthetic construct tgaattcgagctcggtaccccgcctttgtgttgatccc 48 DNA PAT misc_feature 1..48 note 16R source 1..48 mol_type other DNA organism synthetic construct ggtcttgattcatgaattccggccttgctgatcgcttcgccagattgg 48 DNA PAT misc_feature 1..48 note 17F source 1..48 mol_type other DNA organism synthetic construct ccaatctggcgaagcgatcagcaaggccggaattcatgaatcaagacc 38 DNA PAT misc_feature 1..38 note 18R source 1..38 mol_type other DNA organism synthetic construct gtcgactctagaggatccccgctctggaactgcaacag 48 DNA PAT misc_feature 1..48 note 19R source 1..48 mol_type other DNA organism synthetic construct ggtcttgattcatgaattcctgtcacgctgatcgcttcgccagattgg 48 DNA PAT misc_feature 1..48 note 20F source 1..48 mol_type other DNA organism synthetic construct ccaatctggcgaagcgatcagcgtgacaggaattcatgaatcaagacc 48 DNA PAT misc_feature 1..48 note 21R source 1..48 mol_type other DNA organism synthetic construct ggtcttgattcatgaattccagcgaagctgatcgcttcgccagattgg 48 DNA PAT misc_feature 1..48 note 22F source 1..48 mol_type other DNA organism synthetic construct ccaatctggcgaagcgatcagcttcgctggaattcatgaatcaagacc 48 DNA PAT misc_feature 1..48 note 23R source 1..48 mol_type other DNA organism synthetic construct ggtcttgattcatgaattgaaatcgacctgatcgcttcgccagattgg 48 DNA PAT misc_feature 1..48 note 24F source 1..48 mol_type other DNA organism synthetic construct ccaatctggcgaagcgatcaggtcgatttcaattcatgaatcaagacc 17 DNA PAT misc_feature 1..17 note 25F source 1..17 mol_type other DNA organism synthetic construct cacgcaccctcgatgtg 17 DNA PAT misc_feature 1..17 note 26R source 1..17 mol_type other DNA organism synthetic construct ccagcttcttcgggagc 35 DNA PAT misc_feature 1..35 note 27R source 1..35 mol_type other DNA organism synthetic construct gaaggcgaggagcctgcagaattccaatctagctg 35 DNA PAT misc_feature 1..35 note 28F source 1..35 mol_type other DNA organism synthetic construct cagctagattggaattctgcaggctcctcgccttc 35 DNA PAT misc_feature 1..35 note 29R source 1..35 mol_type other DNA organism synthetic construct actctagaggatcccccagctcaatatcttgcgcg 17 DNA PAT misc_feature 1..17 note 30F source 1..17 mol_type other DNA organism synthetic construct cccaaatgaaccccgtg 17 DNA PAT misc_feature 1..17 note 31R source 1..17 mol_type other DNA organism synthetic construct gatgccgtgcgtgagcg 000 000 000 000 000