EP 2023-11-29 JWJ02973WO1 EP PCT/EP2022/083943 2022-11-30 Eberhard Karls Universität Tübingen Eberhard Karls Universitat Tubingen CHEMICALLY MODIFIED ANTISENSE OLIGONUCLEOTIDES (ASOS) AND COMPOSITIONS COMPRISING THE SAME FOR RNA EDITING 155 59 DNA PAT modified_base 31 mod_base i source 1..59 mol_type other DNA organism synthetic construct misc_feature order(1..28,32..59) note RNA misc_feature 29..31 note DNA misc_feature 1..59 note v117.26 catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.39 modified_base 31 mod_base i misc_feature order(1..28,32..59) note RNA misc_feature 29..31 note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.42 modified_base 31 mod_base i misc_feature order(1..3,6..9,12,15..18,21..28,32..33,36,39..40,43,45,48..51,53,55,57..59) note RNA misc_feature order(4..5,10..11,13..14,19..20,29..31,34..35,37..38,41..42,44,46..47,52,54,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.43 modified_base 31 mod_base i misc_feature order(1..3,6..10,12..13,15..19,21..28,32..33,35..36,39..41,43..46,48..53,55..59) note RNA misc_feature order(4..5,11,14,20,29..31,34,37..38,42,47,54) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.44 modified_base 31 mod_base i misc_feature order(1..9,11..12,14..18,20..28,32..34,36..40,42..43,45,47..51,53..55,57..59) note RNA misc_feature order(10,13,19,29..31,35,41,44,46,52,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.45 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..41,43..45,47..51,53..55,57..59) note RNA misc_feature order(5,11,14,20,29..31,35,38,42,46,52,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.46 modified_base 31 mod_base i misc_feature order(1..3,5..9,11..12,14..18,20..28,32..33,35..36,38..40,42..43,45..46,48..53,55..59) note RNA misc_feature order(4,10,13,19,29..31,34,37,41,44,47,54) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.47 modified_base 31 mod_base i misc_feature order(1..3,6..10,12..13,15..19,21..28,32..33,36,39..41,43..45,48..51,53,55,57..59) note RNA misc_feature order(4..5,11,14,20,29..31,34..35,37..38,42,46..47,52,54,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.48 modified_base 31 mod_base i misc_feature order(1..3,6..10,12..13,15..19,21..28,32..33,36,39..40,43,45,48..51,53,55,57..59) note RNA misc_feature order(4..5,11,14,20,29..31,34..35,37..38,41..42,44,46..47,52,54,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.49 modified_base 31 mod_base i misc_feature order(1..3,6..9,12,15..18,21..28,32..33,36,39..41,43,45..46,48..51,53,55,57..59) note RNA misc_feature order(4..5,10..11,13..14,19..20,29..31,34..35,37..38,42,44,47,52,54,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.50 modified_base 31 mod_base i misc_feature order(1..3,6..10,11..12,14..19,21..28,32..33,36,39..41,43,45,48..51,53,55,57..59) note RNA misc_feature order(4..5,11,14,20,29..31,34..35,37..38,42,44,46..47,52,54,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.51 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..41,43,45..46,48..51,53,55,57..59) note RNA misc_feature order(5,11,14,20,29..31,35,38,42,44,47,52,54,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.52 modified_base 31 mod_base i misc_feature order(1..3,5..9,11..12,14..18,20..28,32..33,35..36,38..40,42..43,45,47..51,53,55,57..59) note RNA misc_feature order(4,10,13,19,29..31,34,37,41,44,46,52,54,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.53 modified_base 31 mod_base i misc_feature order(1..3,6..9,12,15..18,21..28,32..33,36,39..40,43..45,48..53,55..59) note RNA misc_feature order(4..5,10..11,13..14,19..20,29..31,34..35,37..38,41..42,46..47,54) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.54 modified_base 31 mod_base i misc_feature order(1..3,6..9,12,15..18,21..28,32..33,36,39..40,43,45,48..51,53,55,57..59) note RNA misc_feature order(4..5,10..11,13..14,19..20,29..31,34..35,37..38,41..42,44,46..47,52,54,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.55 modified_base 31 mod_base i misc_feature order(1..3,6..9,11..12,14..18,21..28,32..34,36..37,39..40,43,45,48..51,53,55,57..59) note RNA misc_feature order(4..5,10,13,19..20,29..31,35,38,41..42,44,46..47,52,54,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.56 modified_base 31 mod_base i misc_feature order(1..3,6..9,12,14..19,21..28,32..34,36..37,39..40,43,45,48..51,53,55,57..59) note RNA misc_feature order(4..5,10..11,13,20,29..31,35,38,41..42,44,46..47,52,54,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.57 modified_base 31 mod_base i misc_feature order(1..3,6..9,12,15..19,21..28,32..34,36..37,39..40,43,45,48..51,53,55,57..59) note RNA misc_feature order(4..5,10..11,13..14,20,29..31,35,38,41..42,44,46..47,52,54,56) number DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.58 modified_base 31 mod_base i misc_feature order(1..3,6..10,12..13,15..19,21..28,32..34,36..37,39..40,43,45,48..51,53,55,57..59) note RNA misc_feature order(4..5,11,14,20,29..31,35,38,41..42,44,46..47,52,54,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.59 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..41,43..45,47..51,53..55,57..59) note RNA misc_feature order(5,11,14,20,29..31,35,38,42,46,52,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.60 modified_base 31 mod_base i misc_feature order(1..3,6..10,12..13,15..19,21..28,32..34,36..37,39..40,43,45,48..51,53,55,57..59) note RNA misc_feature order(4..5,11,14,20,29..31,35,38,41..42,44,46..47,52,54,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.62 modified_base 31 mod_base i misc_feature order(1..28,32..59) note RNA misc_feature 29..31 note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.63 modified_base 31 mod_base i misc_feature order(1..3,5..9,11..12,14..18,20..28,32..33,35..36,38..40,42..43,45..46,48..53,55..59) note RNA misc_feature order(4,10,13,19,29..31,34,37,41,44,47,54) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.64 modified_base 31 mod_base i misc_feature order(1..3,6..10,12..13,15..19,21..28,32..33,35..36,39..41,43..46,48..53,55..59) note RNA misc_feature order(4..5,11,14,20,29..31,34,37..38,42,47,54) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.65 modified_base 31 mod_base i misc_feature order(1..9,11..12,14..18,20..28,32..34,36..40,42..43,45,47..51,53..55,57..59) note RNA misc_feature order(10,13,19,29..31,35,41,44,46,52,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.66 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..41,43..45,47..51,53..55,57..59) note RNA misc_feature order(5,11,14,20,29..31,35,38,42,46,52,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.75 modified_base 31 mod_base i misc_feature order(1..9,11..13,15..28,32..33,35..37,39..43,45..51,53..59) note RNA misc_feature order(10,14,29..31,34,38,44,52) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.76 modified_base 31 mod_base i misc_feature order(1..4,6..9,11..12,15..19,21..28,32..33,35..36,39..41,43,45..46,48..51,53..55,57..59) note RNA misc_feature order(5,10,13..14,20,29..31,34,37..38,42,44,47,52,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.77 modified_base 31 mod_base i misc_feature order(1..9,12..18,21..28,32..36,39..45,48..55,57..59) note RNA misc_feature order(10..11,19..20,29..31,37..38,46..47,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.78 modified_base 31 mod_base i misc_feature order(1..28,32..33,36,39..40,43,45,48..51,53,55,57..59) note RNA misc_feature order(29..31,34..35,37..38,41..42,44,46..47,52,54,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.79 modified_base 31 mod_base i misc_feature order(1..3,6..9,12,15..18,21..28,32..59) note RNA misc_feature order(4..5,10..11,13..14,19..20,29..31) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.99 modified_base 31 mod_base i misc_feature order(1..5,7..9,11..13,15..17,19..21,23..25,27..28,32..34,36..38,40..42,44..46,48..50,52..54,56..59) note RNA misc_feature order(6,10,14,18,22,26,29..31,35,39,43,47,51,55) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.100 modified_base 31 mod_base i misc_feature order(1..4,6,8,11..12,14..15,17..20,22..27,32..35,37..38,40..44,46..47,49..59) note RNA misc_feature order(5,7,9..10,13,16,21,28..31,36,39,45,48) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.28 misc_feature order(1..28,32..59) note RNA misc_feature 29..31 note DNA cagacacagaaatcaactcagtcttgatacatccagttcctttagggccatcaagttcc 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.29 misc_feature order(1..28,32..59) note RNA misc_feature 29..31 note DNA cagacacagaaatcaactcagtcttgatacatccagttcctttagggccatcaagttcc 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.30 misc_feature order(1..3,5,7,13..14,17..19,22..25,28,32..34,37..43,48..49,51..52,56..59) note RNA misc_feature order(4,6,8..12,15..16,20..21,26..27,29..31,35..36,44..47,50,53..55) note DNA cagacacagaaatcaactcagtcttgatacatccagttcctttagggccatcaagttcc 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.31 misc_feature order(1..3,5,7..11,13..15,17..20,22..26,28,32..35,37..46,48..49,51..54,56..59) note RNA misc_feature order(4,6,12,16,21,27,29..31,36,47,50,55) note DNA cagacacagaaatcaactcagtcttgatacatccagttcctttagggccatcaagttcc 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.36 misc_feature order(1..28,32..59) note RNA misc_feature 29..31 note DNA cagacacagaaatcaactcagtcttgatacatccagttcctttagggccatcaagttcc 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.37 misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..41,43..45,47..51,53..55,57..59) note RNA misc_feature order(5,11,14,20,29..31,35,38,42,46,52,56) note DNA cagacacagaaatcaactcagtcttgatacatccagttcctttagggccatcaagttcc 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.38 misc_feature order(1..5,7..8,10,12..14,16..19,21..25,27..28,32..34,36..43,45,47..49,51..53,55..59) note RNA misc_feature order(6,9,11,15,20,26,29..31,35,44,46,50,54) note DNA cagacacagaaatcaactcagtcttgatacatccagttcctttagggccatcaagttcc 59 DNA PAT misc_feature 1..59 note V117.39 source 1..59 mol_type other DNA organism synthetic construct misc_feature order(1..3,5,7,9,13..14,17..19,21..26,28,32..34,36..43,45..49,51..52,55..59) note RNA misc_feature order(4,6,8,10..12,15..16,20,27,29..31,35,44,50,53..54) note DNA cagacacagaaatcaactcagtcttgatacatccagttcctttagggccatcaagttcc 59 DNA PAT misc_feature 1..59 note V117.40 source 1..59 mol_type other DNA organism synthetic construct misc_feature order(1..8,10..20,22..25,27..28,32..35,37..44,48..54,56..59) note RNA misc_feature order(9,21,26,29..31,36,45..47,55) note DNA cagacacagaaatcaactcagtcttgatacatccagttcctttagggccatcaagttcc 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.41 misc_feature order(1..28,32..59) note RNA misc_feature 29..31 note DNA cagacacagaaatcaactcagtcttgatacatccagttcctttagggccatcaagttcc 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.20 misc_feature order(1..28,32..59) note RNA misc_feature 29..31 note DNA tttgtccattaaaaacagcatttgcaatacattcaaatccttgaagcaccggctggcac 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.22 misc_feature order(1..7,9..14,16..17,19,21..23,25..26,28,32..36,38..45,47,49..51,53..55,57..59) note RNA misc_feature order(8,15,18,20,24,27,29..31,37,46,48,52,56) note DNA tttgtccattaaaaacagcatttgcaatacattcaaatccttgaagcaccggctggcac 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.23 misc_feature order(1..28,32..59) note RNA misc_feature 29..31 note DNA tttgtccattaaaaacagcatttgcaatacattcaaatccttgaagcaccggctggcac 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.24 misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..41,43..45,47..51,53..55,57..59) note RNA misc_feature order(5,11,14,20,29..31,35,38,42,46,52,56) note DNA tttgtccattaaaaacagcatttgcaatacattcaaatccttgaagcaccggctggcac 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.25 misc_feature order(1..7,9..11,13,15..16,18..19,21..25,27..28,32..34,36,38..43,45,47..50,52..54,56..59) note RNA misc_feature order(8,12,14,17,20,26,29..31,35,37,44,46,51,55) note DNA tttgtccattaaaaacagcatttgcaatacattcaaatccttgaagcaccggctggcac 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.20 modified_base 31 mod_base i misc_feature order(1..28,32..59) note RNA misc_feature 29..31 note DNA ccccattctacagcagtactgagcaatgccntagtcagcaatctttgcaatgatggcag 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.42 modified_base 31 mod_base i misc_feature order(1..4,6..9,11,14,17,19..20,24,32,35..36,39,42..46,48,51,54,57..59) note RNA misc_feature order(5,10,12..13,15..16,18,21..23,25..31,33..34,37..38,40..41,47,49..50,52..53,55..56) note DNA ccccattctacagcagtactgagcaatgccntagtcagcaatctttgcaatgatggcag 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.59 modified_base 31 mod_base i misc_feature order(1..9,11..12,14..15,17..20,22,24..25,27..28,32,34..36,38..39,41..46,48..49,51..52,54..55,57..59) note RNA misc_feature order(10,13,16,21,23,26,29..31,33,37,40,47,50,53,56) note DNA ccccattctacagcagtactgagcaatgccntagtcagcaatctttgcaatgatggcag 59 DNA PAT misc_feature 1..59 note v117.60 source 1..59 mol_type other DNA organism synthetic construct modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..41,43..45,47..51,53..55,57..59) note RNA misc_feature order(5,11,14,20,29..31,35,38,42,46,52,56) note DNA ccccattctacagcagtactgagcaatgccntagtcagcaatctttgcaatgatggcag 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.21 misc_feature order(1..28,32..59) note RNA misc_feature 29..31 note DNA ggtactctcatatgtctttgactgatccacaatcttctggaacatggtccttttcttga 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.27 misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..41,43..45,47..51,53..55,57..59) note RNA misc_feature order(5,11,14,20,29..31,35,38,42,46,52,56) note DNA ggtactctcatatgtctttgactgatccacaatcttctggaacatggtccttttcttga 59 RNA PAT source 1..59 mol_type other RNA organism synthetic construct misc_feature 1..59 note V117.19 ggtgctccttgatgagacgcagtcgtgtgcagcgtttgttgaggctcacactctcaccc 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.20 misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..41,43..45,47..51,53..55,57..59) note RNA misc_feature order(5,11,14,20,29..31,35,38,42,46,52,56) note DNA ggtgctccttgatgagacgcagtcgtgtgcagcgtttgttgaggctcacactctcaccc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v121.10 misc_feature order(1..33,37..40) note RNA misc_feature 34..36 note DNA cggctccctaggcccctcccctcttcaaggggtccacatg 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct misc_feature 1..35 note v121.11 misc_feature order(1..28,32..35) note RNA misc_feature 29..31 note DNA ccctaggcccctcccctcttcaaggggtccacatg 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct misc_feature 1..30 note v121.12 misc_feature order(1..21,25..30) note RNA misc_feature 22..24 note DNA cccctcccctcttcaaggggtccacatggc 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct misc_feature 1..25 note v121.13 misc_feature order(1..16,20..25) note RNA misc_feature 17..19 note DNA cccctcttcaaggggtccacatggc 50 DNA PAT source 1..50 mol_type other DNA organism synthetic construct misc_feature 1..50 note V117.80 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..41,43..45,47..50) note RNA misc_feature order(5,11,14,20,29..31,35,38,41,46) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagcct 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct misc_feature 1..45 note V117.81 misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..41,43..45) note RNA misc_feature order(5,11,14,20,29..31,35,38,42) note DNA modified_base 31 mod_base i catggccccagcagcttcagtccctttctcntcgatggtcagcac 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note V117.82 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..29,32..34,36..40) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA catggccccagcagcttcagtccctttctcntcgatggtc 31 DNA PAT source 1..31 mol_type other DNA organism synthetic construct misc_feature 1..31 note V117.83 modified_base 26 mod_base i misc_feature order(1..5,7..8,10..14,16..23,27..29,31) note RNA misc_feature order(6,9,15,24..26,30) note DNA ccccagcagcttcagtccctttctcntcgat 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.84 modified_base 31 mod_base i misc_feature order(1..28,32..59) note RNA misc_feature 29..31 note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 38 DNA PAT source 1..38 mol_type other DNA organism synthetic construct misc_feature 1..38 note V117.85 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..38) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA catggccccagcagcttcagtccctttctcntcgatgg 36 DNA PAT source 1..36 mol_type other DNA organism synthetic construct misc_feature 1..36 note V117.86 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA catggccccagcagcttcagtccctttctcntcgat 38 DNA PAT source 1..38 mol_type other DNA organism synthetic construct misc_feature 1..38 note V117.87 modified_base 29 mod_base i misc_feature order(1..2,4..8,10..11,13..17,19..26,30..32,34..38) note RNA misc_feature order(3,9,12,18,27..29,33) note DNA tggccccagcagcttcagtccctttctcntcgatggtc 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct misc_feature 1..35 note V117.88 modified_base 26 mod_base i misc_feature order(1..5,7..8,10..14,16..23,27..29,31..35) note RNA misc_feature order(6,9,15,24..26,30) note DNA ccccagcagcttcagtccctttctcntcgatggtc 38 DNA PAT misc_feature 1..38 note V117.89 source 1..38 mol_type other DNA organism synthetic construct modified_base 30 mod_base i misc_feature order(1..3,5..9,11..12,14..18,20..27,31..33,35..38) note RNA misc_feature order(4,10,13,19,28..30,34) note DNA atggccccagcagcttcagtccctttctcntcgatggt 36 DNA PAT source 1..36 mol_type other DNA organism synthetic construct misc_feature 1..36 note V117.90 modified_base 29 mod_base i misc_feature order(1..2,4..8,10..11,13..17,19..26,30..32,34..36) note RNA misc_feature order(3,9,12,18,27..29,33) note DNA tggccccagcagcttcagtccctttctcntcgatgg 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct misc_feature 1..34 note V117.91 modified_base 28 mod_base i misc_feature order(1,3..7,9..10,12..16,18..25,29..31,33..34) note RNA misc_feature order(2,8,11,17,26..28,32) note DNA ggccccagcagcttcagtccctttctcntcgatg 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct misc_feature 1..33 note v117.141 modified_base 28 mod_base i misc_feature order(1,3..7,9..10,12..16,18..25,29..31,33) note RNA misc_feature order(2,8,11,17,26..28,32) note DNA ggccccagcagcttcagtccctttctcntcgat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct misc_feature 1..32 note v117.142 modified_base 27 mod_base i misc_feature order(2..6,8..9,11..15,17..24,28..30,32) note RNA misc_feature order(1,7,10,16,25..27,31) note DNA gccccagcagcttcagtccctttctcntcgat 31 DNA PAT source 1..31 mol_type other DNA organism synthetic construct misc_feature 1..31 note Block design_31nt modified_base 26 mod_base i misc_feature order(1..23,27..31) note RNA misc_feature 24..26 note DNA ccccagcagcttcagtccctttctcntcgat 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note Block design_40nt modified_base 31 mod_base i misc_feature order(1..28,32..40) note RNA misc_feature 29..31 note DNA catggccccagcagcttcagtccctttctcntcgatggtc 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct misc_feature 1..33 note v117.167 modified_base 28 mod_base i misc_feature order(1..25,29..33) note RNA misc_feature 26..28 note DNA ggccccagcagcttcagtccctttctcntcgat 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct misc_feature 1..33 note v117.168 modified_base 28 mod_base i misc_feature order(1..25,29..33) note RNA misc_feature 26..28 note DNA ggccccagcagcttcagtccctttctcntcgat 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct misc_feature 1..33 note v117.177 modified_base 29 mod_base i misc_feature order(1..2,4..8,10..11,13..17,19..26,30..32) note RNA misc_feature order(3,9,12,18,27..29,33) note DNA tggccccagcagcttcagtccctttctcntcga 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct misc_feature 1..33 note v117.178 modified_base 27 mod_base i misc_feature order(2..6,8..9,11..15,17..24,28..30,32..33) note RNA misc_feature order(1,7,10,16,25..27,31) note DNA gccccagcagcttcagtccctttctcntcgatg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct misc_feature 1..32 note v117.169 modified_base 27 mod_base i misc_feature order(1..24,28..32) note RNA misc_feature 25..27 note DNA gccccagcagcttcagtccctttctcntcgat 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct misc_feature 1..32 note v117.170 modified_base 27 mod_base i misc_feature order(1..24,28..32) note RNA misc_feature 25..27 note DNA gccccagcagcttcagtccctttctcntcgat 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note V117.42 misc_feature order(1..8,10..20,22..25,27..28,32..35,37..40) note RNA misc_feature order(9,21,26,29..31,36) note DNA cagacacagaaatcaactcagtcttgatacatccagttcc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.44 misc_feature order(1..28,32..40) note RNA misc_feature 29..31 note DNA cagacacagaaatcaactcagtcttgatacatccagttcc 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct misc_feature order(1..5,7..17,19..22,24..25,29..33) note RNA misc_feature order(6,18,23,26..28) note DNA misc_feature 1..33 note v117.56 acacagaaatcaactcagtcttgatacatccag 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct misc_feature 1..33 note v117.57 misc_feature order(1..25,29..33) note RNA misc_feature 26..28 note DNA acacagaaatcaactcagtcttgatacatccag 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.22 modified_base 31 mod_base i misc_feature order(1..28,32..59) note RNA misc_feature 29..31 note DNA gcccttgccactcagggaaggagctgtggcngtggcaccagaatggattccagaatcca 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note V117.23 modified_base 31 mod_base i misc_feature order(1..28,32..40) note RNA misc_feature 29..31 note DNA gcccttgccactcagggaaggagctgtggcngtggcacca 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.24 modified_base 31 mod_base i misc_feature order(1..9,11..13,15..17,20..21,23..28,32..36,38..40) note RNA misc_feature order(10,14,18..19,22,29..31,37) note DNA gcccttgccactcagggaaggagctgtggcngtggcacca 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.25 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..40) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA gcccttgccactcagggaaggagctgtggcngtggcacca 37 DNA PAT source 1..37 mol_type other DNA organism synthetic construct misc_feature 1..37 note V117.29 modified_base 31 mod_base i misc_feature order(1..9,11..13,15..17,20..21,23..28,32..37) note RNA misc_feature order(10,14,18..19,22,29..31) note DNA gcccttgccactcagggaaggagctgtggcngtggca 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct misc_feature 1..45 note V120.2 misc_feature order(1..33,37..45) note RNA misc_feature 34..36 note DNA accgctttgtccattaaaaacagcatttgcaatacattcaaatcc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.28 misc_feature order(1..7,9..11,13,15..16,18..19,21..25,27..28,32..34,36,38..40) note RNA misc_feature order(8,12,14,17,20,26,29..31,35,37) note DNA tttgtccattaaaaacagcatttgcaatacattcaaatcc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note V117.26 misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..40) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA tttgtccattaaaaacagcatttgcaatacattcaaatcc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.27 misc_feature order(1..3,5..17,19..23,25..28,32..40) note RNA misc_feature order(4,18,24,29..31) note DNA tttgtccattaaaaacagcatttgcaatacattcaaatcc 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct misc_feature 1..45 note v117.29 misc_feature order(1..3,5..8,10..22,24..28,30..33,37..45) note RNA misc_feature order(4,9,23,29,34..36) note DNA accgctttgtccattaaaaacagcatttgcaatacattcaaatcc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.39 misc_feature order(1..28,32..40) note RNA misc_feature 29..31 note DNA tttgtccattaaaaacagcatttgcaatacattcaaatcc 33 DNA PAT misc_feature 1..33 note v117.40 source 1..33 mol_type other DNA organism synthetic construct misc_feature order(1..25,29..33) note RNA misc_feature 26..28 note DNA gtccattaaaaacagcatttgcaatacattcaa 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct misc_feature 1..33 note v117.41 misc_feature order(2..14,16..20,22..25,29..33) note RNA misc_feature order(1,15,21,26..28) note DNA gtccattaaaaacagcatttgcaatacattcaa 32 DNA PAT misc_feature 1..32 note v117.42 source 1..32 mol_type other DNA organism synthetic construct misc_feature order(1..13,15..19,21..24,28..32) note RNA misc_feature order(14,20,25..27) note DNA tccattaaaaacagcatttgcaatacattcaa 31 DNA PAT source 1..31 mol_type other DNA organism synthetic construct misc_feature 1..31 note v117.43 misc_feature order(1..12,14..18,20..23,27..31) note RNA misc_feature order(13,19,24..26) note DNA ccattaaaaacagcatttgcaatacattcaa 38 DNA PAT source 1..38 mol_type other DNA organism synthetic construct misc_feature 1..38 note v117.44 misc_feature order(1..3,5..17,19..23,25..28,32..38) note RNA misc_feature order(4,18,24,29..31) note DNA tttgtccattaaaaacagcatttgcaatacattcaaat 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.43 misc_feature order(1..28,32..40) note RNA misc_feature 29..31 note DNA cagacacagaaatcaactcagtcttgatacatccagttcc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.45 misc_feature order(1..8,10..28,32..35,37..40) note RNA misc_feature order(9,29..31,36) note DNA cagacacagaaatcaactcagtcttgatacatccagttcc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.46 misc_feature order(1..20,22..25,27..28,32..40) note RNA misc_feature order(21,26,29..31) note DNA cagacacagaaatcaactcagtcttgatacatccagttcc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.47 misc_feature order(1..25,27..28,32..35,37..40) note RNA misc_feature order(26,29..31,36) note DNA cagacacagaaatcaactcagtcttgatacatccagttcc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.48 misc_feature order(1..8,10..20,22..28,32..40) note RNA misc_feature order(9,21,29..31) note DNA cagacacagaaatcaactcagtcttgatacatccagttcc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.101 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..40) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.102 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..40) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.103 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..40) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.104 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,34,36..40) note RNA misc_feature order(5,11,14,20,29..33,35) note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.105 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,33..34,36..40) note RNA misc_feature order(5,11,14,20,29..32,35) note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.106 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32,34,36..40) note RNA misc_feature order(5,11,14,20,29..31,33,35) note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.118 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,33..34,36..40) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA misc_feature 32 note oN = 2'-MOE catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.119 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,33..34,36..40) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA misc_feature 32 note oN = 2'-MOE catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.120 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,34,36..40) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA misc_feature 32..33 note oN = 2'-MOE catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.124 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32,34,36..40) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA misc_feature 33 note oN = 2'-MOE catggccccagcagcttcagtccctttctcntcgatggtc 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.19 modified_base 31 mod_base i misc_feature order(1..30,32..59) note RNA misc_feature 31 note DNA gcccttgccactcagggaaggagctgtggcngtggcaccagaatggattccagaatcca 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.20 modified_base 31 mod_base i misc_feature order(1..28,32..59) note RNA misc_feature 29..31 note DNA gcccttgccactcagggaaggagctgtggcngtggcaccagaatggattccagaatcca 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note V117.21 modified_base 31 mod_base i misc_feature order(1..28,32..59) note RNA misc_feature 29..31 note DNA gcccttgccactcagggaaggagctgtggcngtggcaccagaatggattccagaatcca 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.68 modified_base 31 mod_base i misc_feature order(4,6..10,12..13,15..19,21..28,32..34,36..37,39..41,43..45,47..51,53..55) note RNA misc_feature order(5,11,14,20,29..31,35,38,42,46,52,56) note DNA misc_feature order(1..3,57..59) note oN = 2'-MOE catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.137 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..40) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.172 modified_base 31 mod_base i misc_feature order(4,6..10,12..13,15..19,21..28,32..34,36..37) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA misc_feature order(1..3,38..40) note oN = 2'-MOE catggccccagcagcttcagtccctttctcntcgatggtc 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.74 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..41,43..45,47..51,53..55,57..59) note RNA misc_feature order(5,11,14,20,29..31,35,38,42,46,52,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.71 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..41,43..45,47..51,53..55,57..59) note RNA misc_feature order(5,11,14,20,29..31,35,38,42,46,52,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.72 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..41,43..45,47..51,53..55,57..59) note RNA misc_feature order(5,11,14,20,29..31,35,38,42,46,52,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.73 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..41,43..45,47..51,53..55,57..59) note RNA misc_feature order(5,11,14,20,29..31,35,38,42,46,52,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.96 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..40) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.107 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..40) note RNA misc_feature order(5,11,14,20,29..31,35,38) note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.108 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..40) note RNA misc_feature order(5,11,14,20,29..31,35,38) note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.109 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..40) note RNA misc_feature order(5,11,14,20,29..31,35,38) note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.132 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..40) note RNA misc_feature order(5,11,14,20,29..31,35,38) note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.133 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..40) note RNA misc_feature order(5,11,14,20,29..31,35,38) note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.97 modified_base 31 mod_base i misc_feature order(2,4,6..10,12..13,15..19,21..28,32..34,36..37,39) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA misc_feature order(1,3,38,40) note lN = LNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.98 modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..23,25..28,32..34,37..38,40) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA misc_feature order(24,36,39) note lN = LNA catggccccagcagcttcagtccctttctcntcgatggtc 36 DNA PAT source 1..36 mol_type other DNA organism synthetic construct misc_feature 1..36 note v117.129 modified_base 31 mod_base i misc_feature order(2,4,6..10,12..13,15..19,21..28,32..34) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA misc_feature order(1,3) note lN = LNA catggccccagcagcttcagtccctttctcntcgat 36 DNA PAT source 1..36 mol_type other DNA organism synthetic construct misc_feature 1..36 note v117.130 modified_base 31 mod_base i misc_feature order(2,4,6,8..10,12..13,15..19,21..28,32..34,36) note RNA misc_feature order(11,14,20,29..31,35) note DNA misc_feature order(1,3,5,7) note lN = LNA catggccccagcagcttcagtccctttctcntcgat 36 DNA PAT source 1..36 mol_type other DNA organism synthetic construct misc_feature 1..36 note v117.131 modified_base 31 mod_base i misc_feature order(2,4,6,8,10,12..13,15..19,21..28,32..34,36) note RNA misc_feature order(14,20,29..31,35) note DNA misc_feature order(1,3,5,7,9,11) note lN = LNA catggccccagcagcttcagtccctttctcntcgat 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.126 modified_base 31 mod_base i misc_feature order(2,4,6..10,12..13,15..19,21..28,32..34,36..37,39) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA misc_feature order(1,3,38,40) note lN = LNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.127 modified_base 31 mod_base i misc_feature order(2,4,6..10,12..13,15..19,21..28,32..34,36..37,39) note RNA misc_feature order(5,11,14,20,29..31,35) note DNA misc_feature order(1,3,38,40) note lN = LNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.121 modified_base 31 mod_base i misc_feature order(1..28,32..40) note RNA misc_feature 29..31 note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.123 modified_base 31 mod_base i misc_feature order(1..28,32..40) note RNA misc_feature 29..31 note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.152 modified_base 31 mod_base i misc_feature order(1..28,32..40) note RNA misc_feature 29..31 note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.153 modified_base 31 mod_base i misc_feature order(1..28,32..40) note RNA misc_feature 29..31 note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.154 modified_base 31 mod_base i misc_feature order(1..28,32..40) note RNA misc_feature 29..31 note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.155 modified_base 31 mod_base i misc_feature order(1..28,32..40) note RNA misc_feature 29..31 note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.158 modified_base 31 mod_base i misc_feature order(1..28,32..40) note RNA misc_feature 29..31 note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.160 modified_base 31 mod_base i misc_feature order(1..28,32..40) note RNA misc_feature 29..31 note DNA catggccccagcagcttcagtccctttctcntcgatggtc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.53 misc_feature order(1..28,32..40) note RNA misc_feature 29..31 note DNA cagacacagaaatcaactcagtcttgatacatccagttcc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.54 misc_feature order(1..28,32..40) note RNA misc_feature 29..31 note DNA cagacacagaaatcaactcagtcttgatacatccagttcc 40 DNA PAT source 1..40 mol_type other DNA organism synthetic construct misc_feature 1..40 note v117.55 misc_feature order(1..28,32..40) note RNA misc_feature 29..31 note DNA cagacacagaaatcaactcagtcttgatacatccagttcc 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct misc_feature 1..45 note v117.30 misc_feature order(1..3,5..8,10..22,24..28,30..33,37..45) note RNA misc_feature order(4,9,23,29,34) note DNA misc_feature 35..36 note aN = 2' FANA accgctttgtccattaaaaacagcatttgcaatacattcaaatcc 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct misc_feature 1..45 note v117.31 misc_feature order(1..3,5..8,10..22,24..28,30..32,37..45) note RNA misc_feature order(4,9,23,29) note DNA misc_feature 33..36 note aN = 2' FANA accgctttgtccattaaaaacagcatttgcaatacattcaaatcc 50 DNA PAT source 1..50 mol_type other DNA organism synthetic construct misc_feature 1..50 note v117.33 misc_feature order(1..34,39..50) note RNA misc_feature 35..38 note aN = 2' FANA tgaccgctttgtccattaaaaacagcatttgcaatacattcaaatccttg 59 DNA PAT source 1..59 mol_type other DNA organism synthetic construct misc_feature 1..59 note v117.59 + Amino modified_base 31 mod_base i misc_feature order(1..4,6..10,12..13,15..19,21..28,32..34,36..37,39..41,43..45,47..51,53..55,57..59) note RNA misc_feature order(5,11,14,20,29..31,35,38,42,46,52,56) note DNA catggccccagcagcttcagtccctttctcntcgatggtcagcacagccttatgcacgg