121301-16620 US US 63/232,840 2021-08-13 ALNYLAM PHARMACEUTICALS, INC. FACTOR XII (F12) iRNA COMPOSITIONS AND METHODS OF USE THEREOF 1340 2036 DNA PAT source 1..2036 mol_type genomic DNA organism Homo sapiens actcctggataggcagctggaccaacggacggatgccatgagggctctgctgctcctggggttcctgctggtgagcttggagtcaacactttcgattccaccttgggaagcccccaaggagcataagtacaaagctgaagagcacacagtcgttctcactgtcaccggggagccctgccacttccccttccagtaccaccggcagctgtaccacaaatgtacccacaagggccggccaggccctcagccctggtgtgctaccacccccaactttgatcaggaccagcgatggggatactgtttggagcccaagaaagtgaaagaccactgcagcaaacacagcccctgccagaaaggagggacctgtgtgaacatgccaagcggcccccactgtctctgtccacaacacctcactggaaaccactgccagaaagagaagtgctttgagcctcagcttctccggtttttccacaagaatgagatatggtatagaactgagcaagcagctgtggccagatgccagtgcaagggtcctgatgcccactgccagcggctggccagccaggcctgccgcaccaacccgtgcctccatgggggtcgctgcctagaggtggagggccaccgcctgtgccactgcccggtgggctacaccggagccttctgcgacgtggacaccaaggcaagctgctatgatggccgcgggctcagctaccgcggcctggccaggaccacgctctcgggtgcgccctgtcagccgtgggcctcggaggccacctaccggaacgtgactgccgagcaagcgcggaactggggactgggcggccacgccttctgccggaacccggacaacgacatccgcccgtggtgcttcgtgctgaaccgcgaccggctgagctgggagtactgcgacctggcacagtgccagaccccaacccaggcggcgcctccgaccccggtgtcccctaggcttcatgtcccactcatgcccgcgcagccggcaccgccgaagcctcagcccacgacccggaccccgcctcagtcccagaccccgggagccttgccggcgaagcgggagcagccgccttccctgaccaggaacggcccactgagctgcgggcagcggctccgcaagagtctgtcttcgatgacccgcgtcgttggcgggctggtggcgctacgcggggcgcacccctacatcgccgcgctgtactggggccacagtttctgcgccggcagcctcatcgccccctgctgggtgctgacggccgctcactgcctgcaggaccggcccgcacccgaggatctgacggtggtgctcggccaggaacgccgtaaccacagctgtgagccgtgccagacgttggccgtgcgctcctaccgcttgcacgaggccttctcgcccgtcagctaccagcacgacctggctctgttgcgccttcaggaggatgcggacggcagctgcgcgctcctgtcgccttacgttcagccggtgtgcctgccaagcggcgccgcgcgaccctccgagaccacgctctgccaggtggccggctggggccaccagttcgagggggcggaggaatatgccagcttcctgcaggaggcgcaggtaccgttcctctccctggagcgctgctcagccccggacgtgcacggatcctccatcctccccggcatgctctgcgcagggttcctcgagggcggcaccgatgcgtgccagggtgattccggaggcccgctggtgtgtgaggaccaagctgcagagcgccggctcaccctgcaaggcatcatcagctggggatcgggctgtggtgaccgcaacaagccaggcgtctacaccgatgtggcctactacctggcctggatccgggagcacaccgtttcctgattgctcagggactcatctttccctccttggtgattccgcagtgagagagtggctggggcatggaaggcaagattgtgtcccattcccccagtgcggccagctccgcgccaggatggcgcaggaactcaataaagtgctttgaaaatgctga 2036 DNA PAT source 1..2036 mol_type genomic DNA organism Homo sapiens tcagcattttcaaagcactttattgagttcctgcgccatcctggcgcggagctggccgcactgggggaatgggacacaatcttgccttccatgccccagccactctctcactgcggaatcaccaaggagggaaagatgagtccctgagcaatcaggaaacggtgtgctcccggatccaggccaggtagtaggccacatcggtgtagacgcctggcttgttgcggtcaccacagcccgatccccagctgatgatgccttgcagggtgagccggcgctctgcagcttggtcctcacacaccagcgggcctccggaatcaccctggcacgcatcggtgccgccctcgaggaaccctgcgcagagcatgccggggaggatggaggatccgtgcacgtccggggctgagcagcgctccagggagaggaacggtacctgcgcctcctgcaggaagctggcatattcctccgccccctcgaactggtggccccagccggccacctggcagagcgtggtctcggagggtcgcgcggcgccgcttggcaggcacaccggctgaacgtaaggcgacaggagcgcgcagctgccgtccgcatcctcctgaaggcgcaacagagccaggtcgtgctggtagctgacgggcgagaaggcctcgtgcaagcggtaggagcgcacggccaacgtctggcacggctcacagctgtggttacggcgttcctggccgagcaccaccgtcagatcctcgggtgcgggccggtcctgcaggcagtgagcggccgtcagcacccagcagggggcgatgaggctgccggcgcagaaactgtggccccagtacagcgcggcgatgtaggggtgcgccccgcgtagcgccaccagcccgccaacgacgcgggtcatcgaagacagactcttgcggagccgctgcccgcagctcagtgggccgttcctggtcagggaaggcggctgctcccgcttcgccggcaaggctcccggggtctgggactgaggcggggtccgggtcgtgggctgaggcttcggcggtgccggctgcgcgggcatgagtgggacatgaagcctaggggacaccggggtcggaggcgccgcctgggttggggtctggcactgtgccaggtcgcagtactcccagctcagccggtcgcggttcagcacgaagcaccacgggcggatgtcgttgtccgggttccggcagaaggcgtggccgcccagtccccagttccgcgcttgctcggcagtcacgttccggtaggtggcctccgaggcccacggctgacagggcgcacccgagagcgtggtcctggccaggccgcggtagctgagcccgcggccatcatagcagcttgccttggtgtccacgtcgcagaaggctccggtgtagcccaccgggcagtggcacaggcggtggccctccacctctaggcagcgacccccatggaggcacgggttggtgcggcaggcctggctggccagccgctggcagtgggcatcaggacccttgcactggcatctggccacagctgcttgctcagttctataccatatctcattcttgtggaaaaaccggagaagctgaggctcaaagcacttctctttctggcagtggtttccagtgaggtgttgtggacagagacagtgggggccgcttggcatgttcacacaggtccctcctttctggcaggggctgtgtttgctgcagtggtctttcactttcttgggctccaaacagtatccccatcgctggtcctgatcaaagttgggggtggtagcacaccagggctgagggcctggccggcccttgtgggtacatttgtggtacagctgccggtggtactggaaggggaagtggcagggctccccggtgacagtgagaacgactgtgtgctcttcagctttgtacttatgctccttgggggcttcccaaggtggaatcgaaagtgttgactccaagctcaccagcaggaaccccaggagcagcagagccctcatggcatccgtccgttggtccagctgcctatccaggagt 1971 DNA PAT source 1..1971 mol_type genomic DNA organism Mus musculus actcctgggcaggcagcggggccatcggcagacgccatgacggctctgttgttcctggggtctctgctgatgagtctggatctgacactttcggctccaccatggaaagactccaagaaatttaaggacgcacctgatgggcccacagtggttctcactgtggatgggaggctctgccattttccctttcagtaccaccgtcagctacaccacaaatgcatccacaaaaggcggccaggctcccgcccctggtgtgctaccacccccaactttgatgaagatcagcaatggggatactgcttggagcccaagaaagtgaaagaccattgcagcaaacacaacccgtgccacaaaggagggacatgtatcaacacccccaatgggccacactgtctctgccctgaacacctcactgggaaacattgccagaaagagaaatgctttgagcctcagcttctcaagttcttccacgagaatgagctatggtttagaacggggccaggaggtgtggccaggtgcgagtgcaaaggttctgaggctcactgcaagccggtggccagccaggcctgcagcatcaatccgtgccttaatgggggcagctgcctcctcgtggaggaccacccactgtgccgttgccctacaggctacactggatatttttgcgacttggacctttgggcgacctgctatgaaggcagggggctcagctaccggggccaggctggaactacgcaatcgggtgcgccatgtcagcggtggaccgtggaggccacctaccggaacatgactgagaagcaagcgctaagctggggcctgggccaccacgcattttgccggaacccagataatgacacacgtccatggtgcttcgtctggagtggcgacaggctgagctgggactattgcggcctggagcagtgccagacgccaacgtttgcacctctagttgtccctgagagtcaggaggagtccccgtcccaggcaccatctctgtcccatgcaccaaatgactcgaccgatcatcagacttctctgtccaagaccaacacgatgggctgcggacagaggttccgcaagggactgtcctcgttcatgcgcgtggtgggcggactagtggctctgcctgggtcgcacccctacatcgctgcactgtactggggtaacaacttctgcgcgggcagtctcatcgccccctgttgggtgctgaccgcggctcactgcctgcagaatcggccagcgcccgaggaactgacagtggtacttggtcaagatcgccacaaccagagctgcgagtggtgccagactctggctgtgcgctcctaccgccttcacgagggcttctcctccatcacctaccagcacgacttggctctgctgcgcctgcaggaaagcaaaaccaacagttgcgcgatcctgtcacctcacgttcagcctgtgtgtctacccagcggcgcggccccaccctctgagacagtgctctgcgaggtggccggctggggtcaccagttcgagggggctgaagaatactccaccttcctgcaggaggcacaggttccctttatcgccctggatcgctgctccaactctaacgtgcacggagacgccattctccctgggatgctttgcgctggcttcttggagggaggcaccgatgcctgccagggtgactccgggggccctctggtgtgtgaggaaggaactgcagaacatcagctcaccctgcgcggagtcatcagctggggctccggctgtggtgaccgcaacaagcccggagtctacacagacgtggccaactacctggcttggatccagaagcatattgcttcataactaaccaggctttatccttccctccttgtgtgctccttgggatgggacgatgaatgtggcatgctgggtcacagtgaagctagtgccccgacactgggggcacagaaactcaataaagtgctttgaaaacgttcctcagaa 1971 DNA PAT source 1..1971 mol_type genomic DNA organism Mus musculus ttctgaggaacgttttcaaagcactttattgagtttctgtgcccccagtgtcggggcactagcttcactgtgacccagcatgccacattcatcgtcccatcccaaggagcacacaaggagggaaggataaagcctggttagttatgaagcaatatgcttctggatccaagccaggtagttggccacgtctgtgtagactccgggcttgttgcggtcaccacagccggagccccagctgatgactccgcgcagggtgagctgatgttctgcagttccttcctcacacaccagagggcccccggagtcaccctggcaggcatcggtgcctccctccaagaagccagcgcaaagcatcccagggagaatggcgtctccgtgcacgttagagttggagcagcgatccagggcgataaagggaacctgtgcctcctgcaggaaggtggagtattcttcagccccctcgaactggtgaccccagccggccacctcgcagagcactgtctcagagggtggggccgcgccgctgggtagacacacaggctgaacgtgaggtgacaggatcgcgcaactgttggttttgctttcctgcaggcgcagcagagccaagtcgtgctggtaggtgatggaggagaagccctcgtgaaggcggtaggagcgcacagccagagtctggcaccactcgcagctctggttgtggcgatcttgaccaagtaccactgtcagttcctcgggcgctggccgattctgcaggcagtgagccgcggtcagcacccaacagggggcgatgagactgcccgcgcagaagttgttaccccagtacagtgcagcgatgtaggggtgcgacccaggcagagccactagtccgcccaccacgcgcatgaacgaggacagtcccttgcggaacctctgtccgcagcccatcgtgttggtcttggacagagaagtctgatgatcggtcgagtcatttggtgcatgggacagagatggtgcctgggacggggactcctcctgactctcagggacaactagaggtgcaaacgttggcgtctggcactgctccaggccgcaatagtcccagctcagcctgtcgccactccagacgaagcaccatggacgtgtgtcattatctgggttccggcaaaatgcgtggtggcccaggccccagcttagcgcttgcttctcagtcatgttccggtaggtggcctccacggtccaccgctgacatggcgcacccgattgcgtagttccagcctggccccggtagctgagccccctgccttcatagcaggtcgcccaaaggtccaagtcgcaaaaatatccagtgtagcctgtagggcaacggcacagtgggtggtcctccacgaggaggcagctgcccccattaaggcacggattgatgctgcaggcctggctggccaccggcttgcagtgagcctcagaacctttgcactcgcacctggccacacctcctggccccgttctaaaccatagctcattctcgtggaagaacttgagaagctgaggctcaaagcatttctctttctggcaatgtttcccagtgaggtgttcagggcagagacagtgtggcccattgggggtgttgatacatgtccctcctttgtggcacgggttgtgtttgctgcaatggtctttcactttcttgggctccaagcagtatccccattgctgatcttcatcaaagttgggggtggtagcacaccaggggcgggagcctggccgccttttgtggatgcatttgtggtgtagctgacggtggtactgaaagggaaaatggcagagcctcccatccacagtgagaaccactgtgggcccatcaggtgcgtccttaaatttcttggagtctttccatggtggagccgaaagtgtcagatccagactcatcagcagagaccccaggaacaacagagccgtcatggcgtctgccgatggccccgctgcctgcccaggagt 2128 DNA PAT source 1..2128 mol_type genomic DNA organism Rattus norvegicus caggaacccatctcggtactctgcttccaccagccttgccctgctcacgagggttcgacggcgctgttcttctgggctttctgtgaagtctgtgctcctcaggcccaggagggagcttaaccaatctccacctctgaggtttctgagacctttgcccacatctattgatccttactctggggcaggcagctgggccattggcggacgccatgacggctctgttgttcctggggtctctgctgatgagtctggacttgacactttcggcgccaccgtggaagtccaaggagttcaaggacggagctggcgatccctctgtggttctcactgtggacgggaagctctgccactttccctttcagtaccaccgtcgcctgtaccacaaatgcatccacaaaggacagccaggctccaggccctggtgtgctaccacccccaactttgacgaggaccagcaatggggatactgcttggagcccaagaaagtgaaagaccattgcagcaaacacagcccctgccacaaaggagggacgtgtgtcaacacccccaacggcccgcactgtctctgccctgaacacctcaccgggaaacattgccagagagagaaatgctttgagtctcagctcctcaagttcttccatgagaatgagatatggtttagaactgggccaggaggtgtggccaggtgccagtgcaaaggtcctcaggctgtttgcaagctgctgaccagtcaggtttgcagggtcaatccgtgccttaatggaggcacctgcctcctcgtggaggaccaccgactgtgccactgccctgcaggctatgccggacctttttgcgacttagaccttaaggcgacttgctacgaagacaggggtctcagctaccggggccaggctaaaactactctgtcgggtgcaccatgtcagcggtgggcctcggaggccacctaccggaacatgactgagacgcaagctctaagctggggcctgggccaccacgcattctgccggaacccagataatgacacacgtccatggtgctacgtctggagtggcgacaggctgagctgggactactgcgacctggaacagtgccagatgccaacgctcacatctccggtttcccctgagagtcacgacatgctgaagccccggcctcccatattgcagatgcctcagttcccgtctctgtccgatgcactagacaactcgacccgtaatcagaatgttgtgtccaggaccagtacggtggtctgcggacagaggtttcgcaagcgactgtcctcgctcaggcgcgtggtgggcggactagtggctctgcctggatcgcatccctacatcgctgcactgtactggggcgacagcttctgcgcaggcagtctcatcgacccctgctgggtgctgaccgctgctcactgcttgcagaaacggccagcgcccgaggaactgacagtggtacttggtcaagatcgccataaccagagctgcgagaggtgccagactctggctgtgcactcctaccgccttcacgagggcttctcttccaaaacctaccagcatgatttggctctgctgcgcctgcgggggaggaaaaacagctgcgcgatcttgtcgcctcatgtccagccggtgtgtctgcccagcagcgcggccccaccctctgagacagtgctctgcgaggtggccggctggggtcatcagttcgagggggctgaagaatacgccacctttctgcaggaggcacaggtacccttcatctccctggatcgctgctccagctctaacgtgcacggagacgccatcctgcctgggatgctttgtgctggcttcttggagggaggcgccgatgcctgtcagggtgactccgggggtcctctggtatgtgatgaaggagttacagagcgtcagctcaccctgcgaggagtcatcagctggggctccggctgtggtgaccggaacaagcccggggtctacactgacgtggccaattacctggattggatccaggagcatactgctttctaagtaaccagggtcggtccttgcgaagctagtggctgggccccagggacacagaaactcaataaagtgctttgaaaacgttaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2128 DNA PAT source 1..2128 mol_type genomic DNA organism Rattus norvegicus ttttttttttttttttttttttttttttaacgttttcaaagcactttattgagtttctgtgtccctggggcccagccactagcttcgcaaggaccgaccctggttacttagaaagcagtatgctcctggatccaatccaggtaattggccacgtcagtgtagaccccgggcttgttccggtcaccacagccggagccccagctgatgactcctcgcagggtgagctgacgctctgtaactccttcatcacataccagaggacccccggagtcaccctgacaggcatcggcgcctccctccaagaagccagcacaaagcatcccaggcaggatggcgtctccgtgcacgttagagctggagcagcgatccagggagatgaagggtacctgtgcctcctgcagaaaggtggcgtattcttcagccccctcgaactgatgaccccagccggccacctcgcagagcactgtctcagagggtggggccgcgctgctgggcagacacaccggctggacatgaggcgacaagatcgcgcagctgtttttcctcccccgcaggcgcagcagagccaaatcatgctggtaggttttggaagagaagccctcgtgaaggcggtaggagtgcacagccagagtctggcacctctcgcagctctggttatggcgatcttgaccaagtaccactgtcagttcctcgggcgctggccgtttctgcaagcagtgagcagcggtcagcacccagcaggggtcgatgagactgcctgcgcagaagctgtcgccccagtacagtgcagcgatgtagggatgcgatccaggcagagccactagtccgcccaccacgcgcctgagcgaggacagtcgcttgcgaaacctctgtccgcagaccaccgtactggtcctggacacaacattctgattacgggtcgagttgtctagtgcatcggacagagacgggaactgaggcatctgcaatatgggaggccggggcttcagcatgtcgtgactctcaggggaaaccggagatgtgagcgttggcatctggcactgttccaggtcgcagtagtcccagctcagcctgtcgccactccagacgtagcaccatggacgtgtgtcattatctgggttccggcagaatgcgtggtggcccaggccccagcttagagcttgcgtctcagtcatgttccggtaggtggcctccgaggcccaccgctgacatggtgcacccgacagagtagttttagcctggccccggtagctgagacccctgtcttcgtagcaagtcgccttaaggtctaagtcgcaaaaaggtccggcatagcctgcagggcagtggcacagtcggtggtcctccacgaggaggcaggtgcctccattaaggcacggattgaccctgcaaacctgactggtcagcagcttgcaaacagcctgaggacctttgcactggcacctggccacacctcctggcccagttctaaaccatatctcattctcatggaagaacttgaggagctgagactcaaagcatttctctctctggcaatgtttcccggtgaggtgttcagggcagagacagtgcgggccgttgggggtgttgacacacgtccctcctttgtggcaggggctgtgtttgctgcaatggtctttcactttcttgggctccaagcagtatccccattgctggtcctcgtcaaagttgggggtggtagcacaccagggcctggagcctggctgtcctttgtggatgcatttgtggtacaggcgacggtggtactgaaagggaaagtggcagagcttcccgtccacagtgagaaccacagagggatcgccagctccgtccttgaactccttggacttccacggtggcgccgaaagtgtcaagtccagactcatcagcagagaccccaggaacaacagagccgtcatggcgtccgccaatggcccagctgcctgccccagagtaaggatcaatagatgtgggcaaaggtctcagaaacctcagaggtggagattggttaagctccctcctgggcctgaggagcacagacttcacagaaagcccagaagaacagcgccgtcgaaccctcgtgagcagggcaaggctggtggaagcagagtaccgagatgggttcctg 2420 DNA PAT source 1..2420 mol_type genomic DNA organism Macaca fascicularis atgggcattgttgtaagctgctgagtttatggcaatttgttacatgacaatagaaaacgaacacacttcgcagtggactccaagatgcccgtgaaagggagcttctctttgatctccttaacctcctcatctccacaggacccagagcacaagaacgtcccttctcctgcttctagtcccaccgtctagaaaagagaggaggagcccagctcttcatcattccacccccacccactaactcccaacttcctggccctcagcgggtgaccaaggaagtcagtccacttggctttccataaacagcctgtgccccaccaggctcaggggggcagcttgaccaatccctatttccaagacctttggccaaccctattgatctggactcctgggcagacagttggaccaacggacagacgccatgagggctctgctgctcatggggttcctgctggtgagcctggagtcaacactttcgattccaccttggaaagcgcccaaggagcataagtacaaagctgaagagcacacagtcgttctcactgtcaccggggagccctgccacttccccttccagtaccaccggcggctgtaccacaaatgtacccacaagggccggccaggccctcagacctggtgtgctaccacccctaactttgatgaggaccagcgctggggatactgtgtggagcccaagaaagtgaaagaccactgcagtaaacacagcccctgccagaaaggggggacctgtgtgaacacgctgagtggcacccactgtctctgtccacaacacctcactgggaaccactgccagagagagaagtgctttgagcctcagcttctccggtttttccacgagaatgagatatggtatagatctgagcaagcagctgtggccagatgccagtgcaagggtcctgatgcccactgccagcggctggccagccaggcctgccgcaccaacccgtgcctccatgggggtcgctgcctagaggtggagggccaccgcctgtgccactgccccgtgggctacaccggacccttctgcgacttggacaccaaggcgagctgctatgatggccgcgggctcagctaccgcggcctggccaggaccacgctctcgggtgcgccctgtcagccgtggacctcggaggccacctactggaacgtgacggccgagcaagcgcggaactggggactgggcggccacgccttctgccggaacccggacaacgacatccgcccgtggtgcttcgtgctgatcggcgacaggctaagctgggagtactgcgacgtggcacagtgccaggccccaacccaggcggcgcctccgacgccggtgtcccctgggcttcatgtcccactcatgcccccgcagccggcaccgccgaagcttcagcccacgacccggaccccgcctcagtcccagaccccgggagccttgccagtgaagcgggagcagccgcctcgcctgacccggaacggctcagtgagctgcgggcagcggctccgcaagagtctgtcttcgatgacccgcgtcgttggcgggctggtggcgctacgcggggcgcacccctacatcgccgcgctgtactggggccacagtttctgcgccggcagcctcatcgccccctgctgggtgctgacggccgctcactgcctgcaggaccggccggcacccgaggatctgacggtagtactcggccaggaacgccataaccacagctgtgaacagtgccagactctggccgtgcgctcctaccgcttgcacgaggccttctcgcccgacagctaccagcacgacctggctctgttgcgccttcaggaggatgcggacggcagctgcgcgctcctgtcgccttacgttcagccggtgtgcctgccaagcggcgccgcgcgaccctccgagcccgcgctctgccaggtggctggctggggccaccagttcgagggggcggaggaatattccagcttcctgcaggaggcgcaggtacccttcctctccctggagagctgctcagcaccggaggtgcacggagcctccatcctccccggcatgctctgcgcagggttcctcgagggcggcaccgatgcatgccagggtgattccggaggcccgctggtgtgtgaggaccaagccgcagagcgccggctcaccctgcaaggcatcatcagctggggatcgggctgtggtgaccgcaacaagccaggcgtctacaccgatgtggcctactacctggcctggatccgggagcacaccgcttcctgattgctcagggactcatctttccctcctcggtgattccgcagtgggagactggctggggcatggaaggcaaaattgtgtcccattcccccaatgcggccagctccgcgccaggatggcgcaggaactcaataaagtgctttgaaaatgctgagaa 2420 DNA PAT source 1..2420 mol_type genomic DNA organism Macaca fascicularis ttctcagcattttcaaagcactttattgagttcctgcgccatcctggcgcggagctggccgcattgggggaatgggacacaattttgccttccatgccccagccagtctcccactgcggaatcaccgaggagggaaagatgagtccctgagcaatcaggaagcggtgtgctcccggatccaggccaggtagtaggccacatcggtgtagacgcctggcttgttgcggtcaccacagcccgatccccagctgatgatgccttgcagggtgagccggcgctctgcggcttggtcctcacacaccagcgggcctccggaatcaccctggcatgcatcggtgccgccctcgaggaaccctgcgcagagcatgccggggaggatggaggctccgtgcacctccggtgctgagcagctctccagggagaggaagggtacctgcgcctcctgcaggaagctggaatattcctccgccccctcgaactggtggccccagccagccacctggcagagcgcgggctcggagggtcgcgcggcgccgcttggcaggcacaccggctgaacgtaaggcgacaggagcgcgcagctgccgtccgcatcctcctgaaggcgcaacagagccaggtcgtgctggtagctgtcgggcgagaaggcctcgtgcaagcggtaggagcgcacggccagagtctggcactgttcacagctgtggttatggcgttcctggccgagtactaccgtcagatcctcgggtgccggccggtcctgcaggcagtgagcggccgtcagcacccagcagggggcgatgaggctgccggcgcagaaactgtggccccagtacagcgcggcgatgtaggggtgcgccccgcgtagcgccaccagcccgccaacgacgcgggtcatcgaagacagactcttgcggagccgctgcccgcagctcactgagccgttccgggtcaggcgaggcggctgctcccgcttcactggcaaggctcccggggtctgggactgaggcggggtccgggtcgtgggctgaagcttcggcggtgccggctgcgggggcatgagtgggacatgaagcccaggggacaccggcgtcggaggcgccgcctgggttggggcctggcactgtgccacgtcgcagtactcccagcttagcctgtcgccgatcagcacgaagcaccacgggcggatgtcgttgtccgggttccggcagaaggcgtggccgcccagtccccagttccgcgcttgctcggccgtcacgttccagtaggtggcctccgaggtccacggctgacagggcgcacccgagagcgtggtcctggccaggccgcggtagctgagcccgcggccatcatagcagctcgccttggtgtccaagtcgcagaagggtccggtgtagcccacggggcagtggcacaggcggtggccctccacctctaggcagcgacccccatggaggcacgggttggtgcggcaggcctggctggccagccgctggcagtgggcatcaggacccttgcactggcatctggccacagctgcttgctcagatctataccatatctcattctcgtggaaaaaccggagaagctgaggctcaaagcacttctctctctggcagtggttcccagtgaggtgttgtggacagagacagtgggtgccactcagcgtgttcacacaggtcccccctttctggcaggggctgtgtttactgcagtggtctttcactttcttgggctccacacagtatccccagcgctggtcctcatcaaagttaggggtggtagcacaccaggtctgagggcctggccggcccttgtgggtacatttgtggtacagccgccggtggtactggaaggggaagtggcagggctccccggtgacagtgagaacgactgtgtgctcttcagctttgtacttatgctccttgggcgctttccaaggtggaatcgaaagtgttgactccaggctcaccagcaggaaccccatgagcagcagagccctcatggcgtctgtccgttggtccaactgtctgcccaggagtccagatcaatagggttggccaaaggtcttggaaatagggattggtcaagctgcccccctgagcctggtggggcacaggctgtttatggaaagccaagtggactgacttccttggtcacccgctgagggccaggaagttgggagttagtgggtgggggtggaatgatgaagagctgggctcctcctctcttttctagacggtgggactagaagcaggagaagggacgttcttgtgctctgggtcctgtggagatgaggaggttaaggagatcaaagagaagctccctttcacgggcatcttggagtccactgcgaagtgtgttcgttttctattgtcatgtaacaaattgccataaactcagcagcttacaacaatgcccat 2079 DNA PAT source 1..2079 mol_type genomic DNA organism Macaca mulatta attccaccttggaaagcgcccaaggagcataagtacaaagctgaagagcacacagtcgtatgtctcgtgggcatgaatcataccacacagaggccaggaccttcaatgggcaaggaaggatcaagagctggtctctggcattcgaatgcctctgaatcccagctttatcacttatgagctgggtgactctggttctcactgtcaccggggagccctgccacttccccttccagtaccaccggcggctgtaccacaaatgtacccacaagggccggccaggccctcagacctggtgtgctaccacccctaactttgatgaggaccagcgatggggatactgtgtggagcccaagaaagtgaaagaccactgcagtaaacacagcccctgccagaaaggggggacctgtgtgaacacgctgagtggcacccactgtctctgtccacaacacctcactgggaaccactgccagagagagaagtgctttgagcctcagcttctccggtttttccacgagaatgagatatggtatagatctgagcaagcagctgtggccagatgccagtgcaagggtcctgatgcccactgccagcggctggccagccaggcctgccgcaccaacccgtgcctccatgggggtcgctgcctagaggtggagggccaccgcctgtgccactgccccgtgggctacaccggacccttctgcgacttggacaccaaggcgagctgctatgatggccgcgggctcagctaccgcggcctggccaggaccacgctctcgggtgcgccctgtcagccgtggacctcggaggccacctactggaacgtgacggccgagcaagcgcggaactggggactgggcggccacgccttctgccggaacccggacaacgacatccgcccgtggtgcttcgtgctgatcggcgacaggctaagctgggagtactgcgacgtggcacagtgccaggccccaacccaggcggcgcctccgacgccggtgtcccctgggcttcatgtcccactcatgcccccgcagccggcaccgccgaagcttcagcccacgacccggaccccgcctcagtcccagaccccgggagccttgccagtgaagcaggagcagccgcctcgcctgacccggaacggctcagtgagctgcgggcagcggctccgcaagagtctgtcttcgatgacccgcgtcgttggcgggctggtggcgctacgcggggcgcacccctacatcgccgcgctgtactggggccacagtttctgcgccggcagcctcatcgccccctgctgggtgctgacggccgcccactgcctgcaggaccggccggcacccgaggatctgacggtagtactcggccaggaacgccataaccacagctgtgaacagtgccagactctggccgtgcgctcctaccgcttgcacgaggccttctcgcccgacagctaccagcacgacctggctctgttgcgccttcaggaggatgcggacggcagctgcgcgctcctgtcgccttacgttcagccggtgtgcctgccaagcggcgccgcgcgaccctccgagcccgcgctctgccaggtggctggctggggccaccagttcgagggggcggaggaatattccagcttcctgcaggaggcgcaggtacccttcctctccctggagagctgctcagcaccggaggtgcacggagcttccatcctccccggcatgctctgcgcagggttcctcgagggcggcaccgatgcatgccagggtgattccggaggcccgctggtgtgtgaggaccaagccgcagagcgccggctcaccctgcaaggcatcatcagctggggatcgggctgtggtgaccgcaacaagccaggcgtctacaccgatgtggcctactacctggcctggatccgggagcacaccgcttcctgattgctcagggactcatctttccctcctcggtgattccgcagtgggagactggctggggcatggaaggcaaaattgtgtcccattcccccaatgcggccagctccgcgccaggatggcgcaggaactcaataaagtgctttgaaaatgctgagaa 2079 DNA PAT source 1..2079 mol_type genomic DNA organism Macaca mulatta ttctcagcattttcaaagcactttattgagttcctgcgccatcctggcgcggagctggccgcattgggggaatgggacacaattttgccttccatgccccagccagtctcccactgcggaatcaccgaggagggaaagatgagtccctgagcaatcaggaagcggtgtgctcccggatccaggccaggtagtaggccacatcggtgtagacgcctggcttgttgcggtcaccacagcccgatccccagctgatgatgccttgcagggtgagccggcgctctgcggcttggtcctcacacaccagcgggcctccggaatcaccctggcatgcatcggtgccgccctcgaggaaccctgcgcagagcatgccggggaggatggaagctccgtgcacctccggtgctgagcagctctccagggagaggaagggtacctgcgcctcctgcaggaagctggaatattcctccgccccctcgaactggtggccccagccagccacctggcagagcgcgggctcggagggtcgcgcggcgccgcttggcaggcacaccggctgaacgtaaggcgacaggagcgcgcagctgccgtccgcatcctcctgaaggcgcaacagagccaggtcgtgctggtagctgtcgggcgagaaggcctcgtgcaagcggtaggagcgcacggccagagtctggcactgttcacagctgtggttatggcgttcctggccgagtactaccgtcagatcctcgggtgccggccggtcctgcaggcagtgggcggccgtcagcacccagcagggggcgatgaggctgccggcgcagaaactgtggccccagtacagcgcggcgatgtaggggtgcgccccgcgtagcgccaccagcccgccaacgacgcgggtcatcgaagacagactcttgcggagccgctgcccgcagctcactgagccgttccgggtcaggcgaggcggctgctcctgcttcactggcaaggctcccggggtctgggactgaggcggggtccgggtcgtgggctgaagcttcggcggtgccggctgcgggggcatgagtgggacatgaagcccaggggacaccggcgtcggaggcgccgcctgggttggggcctggcactgtgccacgtcgcagtactcccagcttagcctgtcgccgatcagcacgaagcaccacgggcggatgtcgttgtccgggttccggcagaaggcgtggccgcccagtccccagttccgcgcttgctcggccgtcacgttccagtaggtggcctccgaggtccacggctgacagggcgcacccgagagcgtggtcctggccaggccgcggtagctgagcccgcggccatcatagcagctcgccttggtgtccaagtcgcagaagggtccggtgtagcccacggggcagtggcacaggcggtggccctccacctctaggcagcgacccccatggaggcacgggttggtgcggcaggcctggctggccagccgctggcagtgggcatcaggacccttgcactggcatctggccacagctgcttgctcagatctataccatatctcattctcgtggaaaaaccggagaagctgaggctcaaagcacttctctctctggcagtggttcccagtgaggtgttgtggacagagacagtgggtgccactcagcgtgttcacacaggtcccccctttctggcaggggctgtgtttactgcagtggtctttcactttcttgggctccacacagtatccccatcgctggtcctcatcaaagttaggggtggtagcacaccaggtctgagggcctggccggcccttgtgggtacatttgtggtacagccgccggtggtactggaaggggaagtggcagggctccccggtgacagtgagaaccagagtcacccagctcataagtgataaagctgggattcagaggcattcgaatgccagagaccagctcttgatccttccttgcccattgaaggtcctggcctctgtgtggtatgattcatgcccacgagacatacgactgtgtgctcttcagctttgtacttatgctccttgggcgctttccaaggtggaat 21 RNA PAT modified_base 20..21 mod_base OTHER note thymine misc_feature 1..21 note Synthetic modified_base 4 mod_base OTHER note adenosine-3'-phosphate modified_base 6 mod_base OTHER note guanosine-3'-phosphate modified_base 9 mod_base OTHER note guanosine-3'-phosphate modified_base 10 mod_base OTHER note Adenosine-3'-phosphate modified_base 11 mod_base OTHER note guanosine-3'-phosphate modified_base 13 mod_base OTHER note adenosine-3'-phosphate modified_base 18 mod_base OTHER note guanosine-3'-phosphate modified_base 19 mod_base OTHER note adenosine-3'-phosphate modified_base 20 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 21 mod_base OTHER note 2`-deoxythimidine -3`-phosphate source 1..21 mol_type other RNA organism synthetic construct cttacgctgagtacttcgatt 21 RNA PAT modified_base 20..21 mod_base OTHER note thymine misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note Uridine-3'-phosphate modified_base 2 mod_base OTHER note cytidine-3'-phosphate modified_base 3 mod_base OTHER note guanosine-3'-phosphate modified_base 4 mod_base OTHER note adenosine-3'-phosphate modified_base 5 mod_base OTHER note adenosine-3'-phosphate modified_base 6 mod_base OTHER note guanosine-3'-phosphate modified_base 8 mod_base OTHER note adenosine-3'-phosphate modified_base 9 mod_base OTHER note cytidine-3'-phosphate modified_base 10 mod_base OTHER note uridine-3'-phosphate modified_base 12 mod_base OTHER note adenosine-3'-phosphate modified_base 13 mod_base OTHER note guanosine-3'-phosphate modified_base 14 mod_base OTHER note cytidine-3'-phosphate modified_base 15 mod_base OTHER note guanosine-3'-phosphate modified_base 17 mod_base OTHER note Adenosine-3'-phosphate modified_base 18 mod_base OTHER note Adenosine-3'-phosphate modified_base 19 mod_base OTHER note guanosine-3'-phosphate modified_base 20 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 21 mod_base OTHER note 2`-deoxythimidine -3`-phosphate source 1..21 mol_type other RNA organism synthetic construct tcgaagtactcagcgtaagtt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aactcaataaagtgctttgaa 16 AA PAT REGION 1..16 note Synthetic source 1..16 mol_type protein organism synthetic construct AAVALLPAVLLALLAP 11 AA PAT REGION 1..11 note Synthetic source 1..11 mol_type protein organism synthetic construct AALLPVLLAAP 13 AA PAT source 1..13 mol_type protein organism Human Immunodeficiency Virus GRKKRRQRRRPPQ 16 AA PAT source 1..16 mol_type protein organism Drosophila sp. RQIKIWFQNRRMKWKK 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ttcaaagcactttattgagtttc 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 7 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate source 1..21 mol_type other RNA organism synthetic construct aactcaataaagtgctttgaa 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine -3'-phosphorothioate modified_base 6 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 8 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate source 1..23 mol_type other RNA organism synthetic construct ttcaaagcactttattgagtttc 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aaagagaagtgctttgagcct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aaatgtacccacaagggccgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aacccggacaacgacatccgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aactcaataaagtgctttgat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aactgagcaagcagctgtggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aagaatgagatatggtatagt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aagagcacacagtcgttctct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aagcagctgtggccagatgct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aagctgctatgatggccgcgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aagtacaaagctgaagagcat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aagtgctttgagcctcagctt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aataaagtgctttgaaaatgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct acaaatgtacccacaagggct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct acacagtcgttctcactgtct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct acaccgatgtggcctactact 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct acactttcgattccaccttgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct acactttcgattccaccttgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct acagtcgttctcactgtcact 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct acatcgccgcgctgtactggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct accagcacgacctggctctgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct acccggacaacgacatccgct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct accctgcaaggcatcatcagt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct accgcaacaagccaggcgtct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct acctggctctgttgcgccttt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct acgttcagccggtgtgcctgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct actacctggcctggatccggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct actcaataaagtgctttgaat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct actgagcaagcagctgtggct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct agagaagtgctttgagcctct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct agagcacacagtcgttctcat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct agagtctgtcttcgatgacct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct agatgccagtgcaagggtcct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct agcacgacctggctctgttgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct agccaggcgtctacaccgatt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct agccaggcgtctacaccgatt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct agcccaagaaagtgaaagact 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct agctgaagagcacacagtcgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct agctgctatgatggccgcggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct agctgtaccacaaatgtacct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aggagcataagtacaaagctt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aggagcataagtacaaagctt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aggatggcgcaggaactcaat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aggcgtctacaccgatgtggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aggcttcatgtcccactcatt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct agtcaacactttcgattccat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct agtcaacactttcgattccat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ataaagtgctttgaaaatgct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct atccgcccgtggtgcttcgtt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct atcgggctgtggtgaccgcat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct atgccagtgcaagggtcctgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct atgctctgcgcagggttcctt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct atgtacccacaagggccggct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct attgctcagggactcatcttt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct caaagctgaagagcacacagt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct caaatgtacccacaagggcct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct caagaaagtgaaagaccactt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct caagagtctgtcttcgatgat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct caaggagcataagtacaaagt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cacaaatgtacccacaagggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct caccctgcaaggcatcatcat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct caccgatgtggcctactacct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cacgacctggctctgttgcgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cactgtctctgtccacaacat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cactttcgattccaccttggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cagatgccagtgcaagggtct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cagcacgacctggctctgttt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cagctgtaccacaaatgtact 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cagctgtggccagatgccagt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct caggaactcaataaagtgctt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct caggatggcgcaggaactcat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct caggcgtctacaccgatgtgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cagggactcatctttccctct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cagtgcaagggtcctgatgct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ccacaaatgtacccacaaggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ccacaaatgtacccacaaggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ccagatgccagtgcaagggtt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ccaggcgtctacaccgatgtt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cccaagaaagtgaaagaccat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cccggacaacgacatccgcct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cccggacaacgacatccgcct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ccctgcaaggcatcatcagct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ccgatgtggcctactacctgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ccgcaacaagccaggcgtctt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ccgcaagagtctgtcttcgat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ccggaacccggacaacgacat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ccggaacccggacaacgacat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cctgcaggaggcgcaggtact 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cctgtcgccttacgttcagct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cctgtcgccttacgttcagct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ccttacgttcagccggtgtgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cgcaacaagccaggcgtctat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cgcaggaactcaataaagtgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cgccttacgttcagccggtgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cgctcctgtcgccttacgttt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cggaacccggacaacgacatt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cggctccgcaagagtctgtct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cgtctacaccgatgtggcctt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cgtgccagggtgattccggat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctacatcgccgcgctgtactt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctacctggcctggatccgggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctcaataaagtgctttgaaat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctcaataaagtgctttgaaat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctcagggactcatctttccct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctcctgtcgccttacgttcat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctctgttgcgccttcaggagt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctgaagagcacacagtcgttt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctgattgctcagggactcatt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctgcaaggcatcatcagctgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctgccggaacccggacaacgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctgtaccacaaatgtacccat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctgtcgccttacgttcagcct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctgtctctgtccacaacacct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctgtggtgaccgcaacaagct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cttacgttcagccggtgtgct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cttcgatgacccgcgtcgttt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cttggagtcaacactttcgat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctttgagcctcagcttctcct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gaaagtgaaagaccactgcat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gaacccggacaacgacatcct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gaactcaataaagtgctttgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gaagagcacacagtcgttctt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gaccgcaacaagccaggcgtt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gagcacacagtcgttctcact 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gagcataagtacaaagctgat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gagcctcagcttctccggttt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gagtctgtcttcgatgaccct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gatgccagtgcaagggtcctt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gatggcgcaggaactcaatat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gattgctcagggactcatctt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gcaagagtctgtcttcgatgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gcacacagtcgttctcactgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gcacgacctggctctgttgct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gcacgacctggctctgttgct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gcagctgtggccagatgccat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gcaggaactcaataaagtgct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gccagatgccagtgcaagggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gccaggcgtctacaccgatgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gcccaagaaagtgaaagacct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gccttacgttcagccggtgtt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gcgcaggaactcaataaagtt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gcgccttcaggaggatgcggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gcggctccgcaagagtctgtt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gctcagggactcatctttcct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gctccgcaagagtctgtcttt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gctcctgtcgccttacgttct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gctctgcgcagggttcctcgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gctctgcgcagggttcctcgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gctctgttgcgccttcaggat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gctctgttgcgccttcaggat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gctgaagagcacacagtcgtt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gctgctatgatggccgcgggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gctggtgtgtgaggaccaagt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gctgtggtgaccgcaacaagt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gctgtggtgaccgcaacaagt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gcttcatgtcccactcatgct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gctttgagcctcagcttctct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ggaactcaataaagtgctttt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ggagcataagtacaaagctgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ggagcccaagaaagtgaaagt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ggagtcaacactttcgattct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ggcgtctacaccgatgtggct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ggcgtctacaccgatgtggct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ggctccgcaagagtctgtctt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ggctctgttgcgccttcaggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gggtcctgatgcccactgcct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gtcaacactttcgattccact 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gtcaacactttcgattccact 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gtcgccttacgttcagccggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gtcgccttacgttcagccggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gtcgttctcactgtcaccggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gtctgtcttcgatgacccgct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gtcttcgatgacccgcgtcgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gtgcaagggtcctgatgccct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gtggtgaccgcaacaagccat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gttgcgccttcaggaggatgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gttgcgccttcaggaggatgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct taagtacaaagctgaagagct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct taagtacaaagctgaagagct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tacatcgccgcgctgtactgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tacctggcctggatccgggat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tactacctggcctggatccgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tcaacactttcgattccacct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tcaccctgcaaggcatcatct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tcagccggtgtgcctgccaat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tcaggaggatgcggacggcat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tcagggactcatctttccctt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tccgcaagagtctgtcttcgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tcctgtcgccttacgttcagt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tcgccttacgttcagccggtt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tctctgtccacaacacctcat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tctgttgcgccttcaggaggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgaagagcacacagtcgttct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgagcctcagcttctccggtt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgagctgggagtactgcgact 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgatggccgcgggctcagctt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgcaaggcatcatcagctggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgcaaggcatcatcagctggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgcaagggtcctgatgcccat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgccagtgcaagggtcctgat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgccatgagggctctgctgct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgcgccttcaggaggatgcgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgctcagggactcatctttct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgctcagggactcatctttct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tggagtcaacactttcgattt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tggccagatgccagtgcaagt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tggcctactacctggcctggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tggctctgttgcgccttcagt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tggtgaccgcaacaagccagt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgtaccacaaatgtacccact 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgtctctgtccacaacacctt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgtggccagatgccagtgcat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ttacgttcagccggtgtgcct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ttcatgtcccactcatgccct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ttcgatgacccgcgtcgttgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ttgagcctcagcttctccggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ttggagcccaagaaagtgaat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ttggagtcaacactttcgatt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tttgagcctcagcttctccgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aagagcacacagtcgttctct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aataaagtgctttgaaaatgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct acatcgccgcgctgtactggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct accagcacgacctggctctgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct accctgcaaggcatcatcagt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct accgcaacaagccaggcgtct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct actacctggcctggatccggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct attgctcagggactcatcttt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cagggactcatctttccctct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ccacaaatgtacccacaaggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ccgcaagagtctgtcttcgat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ccggaacccggacaacgacat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cctgtcgccttacgttcagct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cgccttacgttcagccggtgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cgtgccagggtgattccggat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctacctggcctggatccgggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctcagggactcatctttccct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct cttcgatgacccgcgtcgttt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gaagagcacacagtcgttctt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gagcctcagcttctccggttt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gccagatgccagtgcaagggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gccttacgttcagccggtgtt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gcgcaggaactcaataaagtt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gcgccttcaggaggatgcggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gctcagggactcatctttcct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gctctgcgcagggttcctcgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gctctgttgcgccttcaggat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gctttgagcctcagcttctct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ggagtcaacactttcgattct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ggctctgttgcgccttcaggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gtcgccttacgttcagccggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gtcttcgatgacccgcgtcgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gttgcgccttcaggaggatgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tcgccttacgttcagccggtt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgagcctcagcttctccggtt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgcgccttcaggaggatgcgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tgctcagggactcatctttct 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tggagtcaacactttcgattt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tggcctactacctggcctggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ttcgatgacccgcgtcgttgt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ttgagcctcagcttctccggt 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct actcaataaagtgctttgaaa 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct tcaataaagtgctttgaaaat 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct ctcaataaagtgctttgaaaa 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct gaactcaataaagtgctttga 21 RNA PAT misc_feature 1..21 note Synthetic source 1..21 mol_type other RNA organism synthetic construct aataaagtgctttgaaaacgt 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggctcaaagcacttctctttct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acggcccttgtgggtacatttgt 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acggatgtcgttgtccgggttcc 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atcaaagcactttattgagttcc 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accacagctgcttgctcagttct 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct actataccatatctcattcttgt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agagaacgactgtgtgctcttca 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcatctggccacagctgcttgc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acgcggccatcatagcagcttgc 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgctcttcagctttgtacttat 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagctgaggctcaaagcacttct 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acattttcaaagcactttattga 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcccttgtgggtacatttgtgg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agacagtgagaacgactgtgtgc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agtagtaggccacatcggtgtag 23 RNA PAT modified_base 7 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acaaggtggaatcgaaagtgttg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acaaggtggaatcgaaagtgttg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agtgacagtgagaacgactgtgt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accagtacagcgcggcgatgtag 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acagagccaggtcgtgctggtag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcggatgtcgttgtccgggttc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct actgatgatgccttgcagggtga 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agacgcctggcttgttgcggtca 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaaggcgcaacagagccaggtcg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acaggcacaccggctgaacgtaa 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accggatccaggccaggtagtag 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct attcaaagcactttattgagttc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agccacagctgcttgctcagttc 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agaggctcaaagcacttctcttt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgagaacgactgtgtgctcttc 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggtcatcgaagacagactcttg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggacccttgcactggcatctgg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acaacagagccaggtcgtgctgg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aatcggtgtagacgcctggcttg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aatcggtgtagacgcctggcttg 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agtctttcactttcttgggctcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acgactgtgtgctcttcagcttt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accgcggccatcatagcagcttg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggtacatttgtggtacagctgc 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagctttgtacttatgctccttg 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagctttgtacttatgctccttg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct attgagttcctgcgccatcctgg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accacatcggtgtagacgcctgg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aatgagtgggacatgaagcctag 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atggaatcgaaagtgttgactcc 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atggaatcgaaagtgttgactcc 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcattttcaaagcactttattg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aacgaagcaccacgggcggatgt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgcggtcaccacagcccgatcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acaggacccttgcactggcatct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaggaaccctgcgcagagcatgc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agccggcccttgtgggtacattt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaagatgagtccctgagcaatca 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct actgtgtgctcttcagctttgta 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggcccttgtgggtacatttgtg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagtggtctttcactttcttggg 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atcatcgaagacagactcttgcg 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct actttgtacttatgctccttggg 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acccttgtgggtacatttgtggt 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgatgatgccttgcagggtgag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggtagtaggccacatcggtgta 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acgcaacagagccaggtcgtgct 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgttgtggacagagacagtggg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accaaggtggaatcgaaagtgtt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agacccttgcactggcatctggc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaacagagccaggtcgtgctggt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agtacatttgtggtacagctgcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct actggcatctggccacagctgct 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagcactttattgagttcctgcg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgagttcctgcgccatcctggc 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acacatcggtgtagacgcctggc 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agagggaaagatgagtccctgag 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcatcaggacccttgcactggc 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accttgtgggtacatttgtggta 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accttgtgggtacatttgtggta 23 RNA PAT modified_base 7 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aacccttgcactggcatctggcc 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aacatcggtgtagacgcctggct 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atggtctttcactttcttgggct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggcggatgtcgttgtccgggtt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggcggatgtcgttgtccgggtt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agctgatgatgccttgcagggtg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acaggtagtaggccacatcggtg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagacgcctggcttgttgcggtc 23 RNA PAT modified_base 2 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atcgaagacagactcttgcggag 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgtcgttgtccgggttccggca 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgtcgttgtccgggttccggca 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agtacctgcgcctcctgcaggaa 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agctgaacgtaaggcgacaggag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agctgaacgtaaggcgacaggag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acacaccggctgaacgtaaggcg 23 RNA PAT modified_base 2 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atagacgcctggcttgttgcggt 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acactttattgagttcctgcgcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acaccggctgaacgtaaggcgac 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaacgtaaggcgacaggagcgcg 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aatgtcgttgtccgggttccggc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agacagactcttgcggagccgct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaggccacatcggtgtagacgcc 23 RNA PAT modified_base 2 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atccggaatcaccctggcacgca 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagtacagcgcggcgatgtaggg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acccggatccaggccaggtagta 23 RNA PAT modified_base 2 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atttcaaagcactttattgagtt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atttcaaagcactttattgagtt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agggaaagatgagtccctgagca 23 RNA PAT modified_base 2 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgaacgtaaggcgacaggagcg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct actcctgaaggcgcaacagagcc 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaacgactgtgtgctcttcagct 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aatgagtccctgagcaatcagga 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acagctgatgatgccttgcaggg 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acgttgtccgggttccggcagaa 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgggtacatttgtggtacagct 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggctgaacgtaaggcgacagga 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggtgttgtggacagagacagtg 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcttgttgcggtcaccacagcc 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcacaccggctgaacgtaaggc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaacgacgcgggtcatcgaagac 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atcgaaagtgttgactccaagct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggagaagctgaggctcaaagca 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgcagtggtctttcactttctt 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggatgtcgttgtccgggttccg 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acaaagcactttattgagttcct 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagaacgactgtgtgctcttcag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aacgcctggcttgttgcggtcac 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agtgagaacgactgtgtgctctt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atcagctttgtacttatgctcct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaaccggagaagctgaggctcaa 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agggtcatcgaagacagactctt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaggacccttgcactggcatctg 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atattgagttcctgcgccatcct 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagatgagtccctgagcaatcag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acatcgaagacagactcttgcgg 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acagtgagaacgactgtgtgctc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcaacagagccaggtcgtgctg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcaacagagccaggtcgtgctg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atggcatctggccacagctgctt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcactttattgagttcctgcgc 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acccttgcactggcatctggcca 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acatcggtgtagacgcctggctt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggtctttcactttcttgggctc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aacaccggctgaacgtaaggcga 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aactttattgagttcctgcgcca 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accgcatcctcctgaaggcgcaa 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aacagactcttgcggagccgctg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggaaagatgagtccctgagcaa 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaagacagactcttgcggagccg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agaacgtaaggcgacaggagcgc 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acgaggaaccctgcgcagagcat 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acgaggaaccctgcgcagagcat 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atcctgaaggcgcaacagagcca 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atcctgaaggcgcaacagagcca 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aacgactgtgtgctcttcagctt 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acccgcggccatcatagcagctt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acttggtcctcacacaccagcgg 23 RNA PAT modified_base 7 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acttgttgcggtcaccacagccc 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acttgttgcggtcaccacagccc 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcatgagtgggacatgaagcct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agagaagctgaggctcaaagcac 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaaagcactttattgagttcctg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acagctttgtacttatgctcctt 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct actttcactttcttgggctccaa 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agaatcgaaagtgttgactccaa 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agccacatcggtgtagacgcctg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agccacatcggtgtagacgcctg 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagacagactcttgcggagccgc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acctgaaggcgcaacagagccag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggcagtgggcatcaggaccctt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agtggaatcgaaagtgttgactc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agtggaatcgaaagtgttgactc 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accggctgaacgtaaggcgacag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accggctgaacgtaaggcgacag 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accggtgacagtgagaacgactg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcgggtcatcgaagacagactc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acgacgcgggtcatcgaagacag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agggcatcaggacccttgcactg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atggcttgttgcggtcaccacag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acatcctcctgaaggcgcaacag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acatcctcctgaaggcgcaacag 23 RNA PAT modified_base 7 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agctcttcagctttgtacttatg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agctcttcagctttgtacttatg 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acagtacagcgcggcgatgtagg 23 RNA PAT modified_base 2 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atcccggatccaggccaggtagt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acggatccaggccaggtagtagg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggtggaatcgaaagtgttgact 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agatgatgccttgcagggtgagc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct attggcaggcacaccggctgaac 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgccgtccgcatcctcctgaag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagggaaagatgagtccctgagc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acgaagacagactcttgcggagc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct actgaacgtaaggcgacaggagc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaccggctgaacgtaaggcgaca 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgaggtgttgtggacagagaca 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acctcctgaaggcgcaacagagc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agaacgactgtgtgctcttcagc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaccggagaagctgaggctcaaa 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agtcgcagtactcccagctcagc 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagctgagcccgcggccatcata 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accagctgatgatgccttgcagg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accagctgatgatgccttgcagg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgggcatcaggacccttgcact 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atcaggacccttgcactggcatc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcagcagagccctcatggcatc 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acgcatcctcctgaaggcgcaac 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agaaagatgagtccctgagcaat 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agaaagatgagtccctgagcaat 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaatcgaaagtgttgactccaag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acttgcactggcatctggccaca 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accaggccaggtagtaggccaca 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct actgaaggcgcaacagagccagg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct actggcttgttgcggtcaccaca 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agtgggtacatttgtggtacagc 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaggtgttgtggacagagacagt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgcactggcatctggccacagc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggcacaccggctgaacgtaagg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agggcatgagtgggacatgaagc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acaacgacgcgggtcatcgaaga 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accggagaagctgaggctcaaag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct attcactttcttgggctccaaac 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aatcgaaagtgttgactccaagc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acggagaagctgaggctcaaagc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agagaacgactgtgtgctcttct 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acattttcaaagcactttattct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accagtacagcgcggcgatgtct 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acagagccaggtcgtgctggtct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct actgatgatgccttgcagggtct 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agacgcctggcttgttgcggtct 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accggatccaggccaggtagtct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaagatgagtccctgagcaatct 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agagggaaagatgagtccctgct 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accttgtgggtacatttgtggct 23 RNA PAT modified_base 2 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atcgaagacagactcttgcggct 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgtcgttgtccgggttccggct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agctgaacgtaaggcgacaggct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acaccggctgaacgtaaggcgct 23 RNA PAT modified_base 2 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atccggaatcaccctggcacgct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acccggatccaggccaggtagct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agggaaagatgagtccctgagct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaacgacgcgggtcatcgaagct 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagaacgactgtgtgctcttcct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaaccggagaagctgaggctcct 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acccttgcactggcatctggcct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aacaccggctgaacgtaaggcct 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aactttattgagttcctgcgcct 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accgcatcctcctgaaggcgcct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggaaagatgagtccctgagcct 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acgaggaaccctgcgcagagcct 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atcctgaaggcgcaacagagcct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agagaagctgaggctcaaagcct 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agaatcgaaagtgttgactccct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acctgaaggcgcaacagagccct 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accggctgaacgtaaggcgacct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acgacgcgggtcatcgaagacct 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acatcctcctgaaggcgcaacct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaccggctgaacgtaaggcgact 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaccggagaagctgaggctcact 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acgcatcctcctgaaggcgcact 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agaaagatgagtccctgagcact 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaatcgaaagtgttgactccact 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accaggccaggtagtaggccact 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acaacgacgcgggtcatcgaact 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accggagaagctgaggctcaact 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tttcaaagcactttattgagttc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct attttcaaagcactttattgagt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ttttcaaagcactttattgagtt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tcaaagcactttattgagttcct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acgttttcaaagcactttattga 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aaagagaagtgctttgagcct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aaatgtacccacaagggccgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aacccggacaacgacatccgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aactcaataaagtgctttgat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aactgagcaagcagctgtggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aagaatgagatatggtatagt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aagagcacacagtcgttctct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aagcagctgtggccagatgct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aagctgctatgatggccgcgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aagtacaaagctgaagagcat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aagtgctttgagcctcagctt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aataaagtgctttgaaaatgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct acaaatgtacccacaagggct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct acacagtcgttctcactgtct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct acaccgatgtggcctactact 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct acactttcgattccaccttgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct acactttcgattccaccttgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct acagtcgttctcactgtcact 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct acatcgccgcgctgtactggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct accagcacgacctggctctgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct acccggacaacgacatccgct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct accctgcaaggcatcatcagt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct accgcaacaagccaggcgtct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct acctggctctgttgcgccttt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct acgttcagccggtgtgcctgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct actacctggcctggatccggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct actcaataaagtgctttgaat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct actgagcaagcagctgtggct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct agagaagtgctttgagcctct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct agagcacacagtcgttctcat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct agagtctgtcttcgatgacct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct agatgccagtgcaagggtcct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct agcacgacctggctctgttgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct agccaggcgtctacaccgatt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct agccaggcgtctacaccgatt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct agcccaagaaagtgaaagact 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct agctgaagagcacacagtcgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct agctgctatgatggccgcggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-cytidine modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct agctgtaccacaaatgtacct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aggagcataagtacaaagctt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aggagcataagtacaaagctt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aggatggcgcaggaactcaat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aggcgtctacaccgatgtggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aggcttcatgtcccactcatt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct agtcaacactttcgattccat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct agtcaacactttcgattccat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ataaagtgctttgaaaatgct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct atccgcccgtggtgcttcgtt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct atcgggctgtggtgaccgcat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct atgccagtgcaagggtcctgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct atgctctgcgcagggttcctt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct atgtacccacaagggccggct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct attgctcagggactcatcttt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct caaagctgaagagcacacagt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct caaatgtacccacaagggcct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct caagaaagtgaaagaccactt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct caagagtctgtcttcgatgat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct caaggagcataagtacaaagt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cacaaatgtacccacaagggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct caccctgcaaggcatcatcat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct caccgatgtggcctactacct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cacgacctggctctgttgcgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cactgtctctgtccacaacat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cactttcgattccaccttggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cagatgccagtgcaagggtct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cagcacgacctggctctgttt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-adenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cagctgtaccacaaatgtact 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cagctgtggccagatgccagt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-adenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct caggaactcaataaagtgctt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct caggatggcgcaggaactcat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct caggcgtctacaccgatgtgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cagggactcatctttccctct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cagtgcaagggtcctgatgct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ccacaaatgtacccacaaggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ccacaaatgtacccacaaggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ccagatgccagtgcaagggtt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ccaggcgtctacaccgatgtt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cccaagaaagtgaaagaccat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cccggacaacgacatccgcct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cccggacaacgacatccgcct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ccctgcaaggcatcatcagct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ccgatgtggcctactacctgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ccgcaacaagccaggcgtctt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ccgcaagagtctgtcttcgat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ccggaacccggacaacgacat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ccggaacccggacaacgacat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cctgcaggaggcgcaggtact 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cctgtcgccttacgttcagct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cctgtcgccttacgttcagct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ccttacgttcagccggtgtgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cgcaacaagccaggcgtctat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cgcaggaactcaataaagtgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cgccttacgttcagccggtgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cgctcctgtcgccttacgttt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cggaacccggacaacgacatt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-cytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cggctccgcaagagtctgtct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-cytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cgtctacaccgatgtggcctt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cgtgccagggtgattccggat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctacatcgccgcgctgtactt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctacctggcctggatccgggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctcaataaagtgctttgaaat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctcaataaagtgctttgaaat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctcagggactcatctttccct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctcctgtcgccttacgttcat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctctgttgcgccttcaggagt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctgaagagcacacagtcgttt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctgattgctcagggactcatt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctgcaaggcatcatcagctgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctgccggaacccggacaacgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctgtaccacaaatgtacccat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctgtcgccttacgttcagcct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctgtctctgtccacaacacct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctgtggtgaccgcaacaagct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cttacgttcagccggtgtgct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cttcgatgacccgcgtcgttt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cttggagtcaacactttcgat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctttgagcctcagcttctcct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gaaagtgaaagaccactgcat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gaacccggacaacgacatcct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gaactcaataaagtgctttgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gaagagcacacagtcgttctt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gaccgcaacaagccaggcgtt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gagcacacagtcgttctcact 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gagcataagtacaaagctgat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gagcctcagcttctccggttt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gagtctgtcttcgatgaccct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gatgccagtgcaagggtcctt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gatggcgcaggaactcaatat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gattgctcagggactcatctt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gcaagagtctgtcttcgatgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gcacacagtcgttctcactgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gcacgacctggctctgttgct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gcacgacctggctctgttgct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gcagctgtggccagatgccat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gcaggaactcaataaagtgct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gccagatgccagtgcaagggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gccaggcgtctacaccgatgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gcccaagaaagtgaaagacct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gccttacgttcagccggtgtt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gcgcaggaactcaataaagtt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gcgccttcaggaggatgcggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gcggctccgcaagagtctgtt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gctcagggactcatctttcct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gctccgcaagagtctgtcttt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gctcctgtcgccttacgttct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gctctgcgcagggttcctcgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gctctgcgcagggttcctcgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gctctgttgcgccttcaggat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gctctgttgcgccttcaggat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gctgaagagcacacagtcgtt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gctgctatgatggccgcgggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gctggtgtgtgaggaccaagt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gctgtggtgaccgcaacaagt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gctgtggtgaccgcaacaagt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gcttcatgtcccactcatgct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gctttgagcctcagcttctct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ggaactcaataaagtgctttt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ggagcataagtacaaagctgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ggagcccaagaaagtgaaagt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ggagtcaacactttcgattct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ggcgtctacaccgatgtggct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ggcgtctacaccgatgtggct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ggctccgcaagagtctgtctt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ggctctgttgcgccttcaggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gggtcctgatgcccactgcct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gtcaacactttcgattccact 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gtcaacactttcgattccact 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gtcgccttacgttcagccggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gtcgccttacgttcagccggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gtcgttctcactgtcaccggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gtctgtcttcgatgacccgct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gtcttcgatgacccgcgtcgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gtgcaagggtcctgatgccct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gtggtgaccgcaacaagccat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gttgcgccttcaggaggatgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gttgcgccttcaggaggatgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct taagtacaaagctgaagagct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct taagtacaaagctgaagagct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tacatcgccgcgctgtactgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tacctggcctggatccgggat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tactacctggcctggatccgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tcaacactttcgattccacct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tcaccctgcaaggcatcatct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tcagccggtgtgcctgccaat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tcaggaggatgcggacggcat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tcagggactcatctttccctt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tccgcaagagtctgtcttcgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tcctgtcgccttacgttcagt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tcgccttacgttcagccggtt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tctctgtccacaacacctcat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tctgttgcgccttcaggaggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgaagagcacacagtcgttct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgagcctcagcttctccggtt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgagctgggagtactgcgact 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgatggccgcgggctcagctt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgcaaggcatcatcagctggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgcaaggcatcatcagctggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgcaagggtcctgatgcccat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgccagtgcaagggtcctgat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgccatgagggctctgctgct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgcgccttcaggaggatgcgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgctcagggactcatctttct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgctcagggactcatctttct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tggagtcaacactttcgattt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tggccagatgccagtgcaagt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tggcctactacctggcctggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tggctctgttgcgccttcagt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tggtgaccgcaacaagccagt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgtaccacaaatgtacccact 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgtctctgtccacaacacctt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgtggccagatgccagtgcat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ttacgttcagccggtgtgcct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ttcatgtcccactcatgccct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ttcgatgacccgcgtcgttgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ttgagcctcagcttctccggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ttggagcccaagaaagtgaat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ttggagtcaacactttcgatt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tttgagcctcagcttctccgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aagagcacacagtcgttctct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aataaagtgctttgaaaatgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct acatcgccgcgctgtactggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct accagcacgacctggctctgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct accctgcaaggcatcatcagt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct accgcaacaagccaggcgtct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct actacctggcctggatccggt 21 RNA PAT misc_feature 1..21 note SyntheticAlvin, Carmen, Alvaro - 3 grilled pork vermicelli bowlJasmine/Leila - 1 grilled pork vermicelli bowl - NO NUTS, EGG ROLLS ON SIDE1 order fresh summer rollsJasmine - 1 regular pho with chickenChrissy - 1 large pho with beef (P3) source 1..21 mol_type other RNA organism synthetic construct attgctcagggactcatcttt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cagggactcatctttccctct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ccacaaatgtacccacaaggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ccgcaagagtctgtcttcgat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ccggaacccggacaacgacat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cctgtcgccttacgttcagct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cgccttacgttcagccggtgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cgtgccagggtgattccggat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctacctggcctggatccgggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctcagggactcatctttccct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct cttcgatgacccgcgtcgttt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gaagagcacacagtcgttctt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gagcctcagcttctccggttt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gccagatgccagtgcaagggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gccttacgttcagccggtgtt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gcgcaggaactcaataaagtt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gcgccttcaggaggatgcggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gctcagggactcatctttcct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gctctgcgcagggttcctcgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gctctgttgcgccttcaggat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gctttgagcctcagcttctct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ggagtcaacactttcgattct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ggctctgttgcgccttcaggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gtcgccttacgttcagccggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gtcttcgatgacccgcgtcgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gttgcgccttcaggaggatgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tcgccttacgttcagccggtt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgagcctcagcttctccggtt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgcgccttcaggaggatgcgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tgctcagggactcatctttct 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tggagtcaacactttcgattt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tggcctactacctggcctggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ttcgatgacccgcgtcgttgt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ttgagcctcagcttctccggt 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 7 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct actcaataaagtgctttgaaa 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 7 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct tcaataaagtgctttgaaaat 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate modified_base 7 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct ctcaataaagtgctttgaaaa 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 9 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct gaactcaataaagtgctttga 21 RNA PAT misc_feature 1..21 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 7 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 9 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 10 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 11 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note L96 source 1..21 mol_type other RNA organism synthetic construct aataaagtgctttgaaaacgt 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggctcaaagcacttctctttct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acggcccttgtgggtacatttgt 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acggatgtcgttgtccgggttcc 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atcaaagcactttattgagttcc 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accacagctgcttgctcagttct 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct actataccatatctcattcttgt 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agagaacgactgtgtgctcttca 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agcatctggccacagctgcttgc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acgcggccatcatagcagcttgc 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythymidine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atgctcttcagctttgtacttat 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroadenosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aagctgaggctcaaagcacttct 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acattttcaaagcactttattga 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agcccttgtgggtacatttgtgg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agacagtgagaacgactgtgtgc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agtagtaggccacatcggtgtag 23 RNA PAT modified_base 7 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acaaggtggaatcgaaagtgttg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acaaggtggaatcgaaagtgttg 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agtgacagtgagaacgactgtgt 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accagtacagcgcggcgatgtag 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acagagccaggtcgtgctggtag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agcggatgtcgttgtccgggttc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct actgatgatgccttgcagggtga 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agacgcctggcttgttgcggtca 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaaggcgcaacagagccaggtcg 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acaggcacaccggctgaacgtaa 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accggatccaggccaggtagtag 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct attcaaagcactttattgagttc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agccacagctgcttgctcagttc 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agaggctcaaagcacttctcttt 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atgagaacgactgtgtgctcttc 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggtcatcgaagacagactcttg 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggacccttgcactggcatctgg 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acaacagagccaggtcgtgctgg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aatcggtgtagacgcctggcttg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroadenosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aatcggtgtagacgcctggcttg 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agtctttcactttcttgggctcc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acgactgtgtgctcttcagcttt 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accgcggccatcatagcagcttg 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggtacatttgtggtacagctgc 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aagctttgtacttatgctccttg 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroadenosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythymidine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aagctttgtacttatgctccttg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct attgagttcctgcgccatcctgg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accacatcggtgtagacgcctgg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroadenosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aatgagtgggacatgaagcctag 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atggaatcgaaagtgttgactcc 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atggaatcgaaagtgttgactcc 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agcattttcaaagcactttattg 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aacgaagcaccacgggcggatgt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atgcggtcaccacagcccgatcc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acaggacccttgcactggcatct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaggaaccctgcgcagagcatgc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agccggcccttgtgggtacattt 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaagatgagtccctgagcaatca 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythymidine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct actgtgtgctcttcagctttgta 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggcccttgtgggtacatttgtg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroadenosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aagtggtctttcactttcttggg 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atcatcgaagacagactcttgcg 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythymidine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct actttgtacttatgctccttggg 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acccttgtgggtacatttgtggt 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythymidine-3`-phosphate modified_base 7 mod_base OTHER note adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atgatgatgccttgcagggtgag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggtagtaggccacatcggtgta 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acgcaacagagccaggtcgtgct 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythymidine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atgttgtggacagagacagtggg 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accaaggtggaatcgaaagtgtt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agacccttgcactggcatctggc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroadenosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaacagagccaggtcgtgctggt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agtacatttgtggtacagctgcc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct actggcatctggccacagctgct 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroadenosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aagcactttattgagttcctgcg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atgagttcctgcgccatcctggc 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acacatcggtgtagacgcctggc 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agagggaaagatgagtccctgag 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agcatcaggacccttgcactggc 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accttgtgggtacatttgtggta 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythymidine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accttgtgggtacatttgtggta 23 RNA PAT modified_base 7 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aacccttgcactggcatctggcc 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aacatcggtgtagacgcctggct 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythymidine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atggtctttcactttcttgggct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggcggatgtcgttgtccgggtt 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggcggatgtcgttgtccgggtt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agctgatgatgccttgcagggtg 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acaggtagtaggccacatcggtg 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aagacgcctggcttgttgcggtc 23 RNA PAT modified_base 2 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atcgaagacagactcttgcggag 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atgtcgttgtccgggttccggca 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atgtcgttgtccgggttccggca 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agtacctgcgcctcctgcaggaa 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agctgaacgtaaggcgacaggag 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agctgaacgtaaggcgacaggag 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acacaccggctgaacgtaaggcg 23 RNA PAT modified_base 2 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atagacgcctggcttgttgcggt 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acactttattgagttcctgcgcc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acaccggctgaacgtaaggcgac 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaacgtaaggcgacaggagcgcg 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aatgtcgttgtccgggttccggc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agacagactcttgcggagccgct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroadenosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaggccacatcggtgtagacgcc 23 RNA PAT modified_base 2 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atccggaatcaccctggcacgca 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroadenosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aagtacagcgcggcgatgtaggg 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acccggatccaggccaggtagta 23 RNA PAT modified_base 2 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atttcaaagcactttattgagtt 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atttcaaagcactttattgagtt 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agggaaagatgagtccctgagca 23 RNA PAT modified_base 2 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atgaacgtaaggcgacaggagcg 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct actcctgaaggcgcaacagagcc 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaacgactgtgtgctcttcagct 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroadenosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aatgagtccctgagcaatcagga 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acagctgatgatgccttgcaggg 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythymidine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acgttgtccgggttccggcagaa 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atgggtacatttgtggtacagct 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggctgaacgtaaggcgacagga 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggtgttgtggacagagacagtg 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agcttgttgcggtcaccacagcc 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agcacaccggctgaacgtaaggc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaacgacgcgggtcatcgaagac 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytodine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atcgaaagtgttgactccaagct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggagaagctgaggctcaaagca 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atgcagtggtctttcactttctt 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggatgtcgttgtccgggttccg 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acaaagcactttattgagttcct 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aagaacgactgtgtgctcttcag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroadenosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aacgcctggcttgttgcggtcac 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agtgagaacgactgtgtgctctt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atcagctttgtacttatgctcct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaaccggagaagctgaggctcaa 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agggtcatcgaagacagactctt 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaggacccttgcactggcatctg 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythymidine-3`-phosphate modified_base 7 mod_base OTHER note adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atattgagttcctgcgccatcct 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroadenosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythymidine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aagatgagtccctgagcaatcag 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acatcgaagacagactcttgcgg 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythymidine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acagtgagaacgactgtgtgctc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agcaacagagccaggtcgtgctg 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agcaacagagccaggtcgtgctg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atggcatctggccacagctgctt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agcactttattgagttcctgcgc 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acccttgcactggcatctggcca 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acatcggtgtagacgcctggctt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggtctttcactttcttgggctc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aacaccggctgaacgtaaggcga 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aactttattgagttcctgcgcca 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accgcatcctcctgaaggcgcaa 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aacagactcttgcggagccgctg 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggaaagatgagtccctgagcaa 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroadenosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaagacagactcttgcggagccg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agaacgtaaggcgacaggagcgc 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acgaggaaccctgcgcagagcat 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acgaggaaccctgcgcagagcat 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atcctgaaggcgcaacagagcca 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythymidine-3`-phosphate modified_base 7 mod_base OTHER note adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atcctgaaggcgcaacagagcca 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aacgactgtgtgctcttcagctt 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acccgcggccatcatagcagctt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acttggtcctcacacaccagcgg 23 RNA PAT modified_base 7 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acttgttgcggtcaccacagccc 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acttgttgcggtcaccacagccc 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agcatgagtgggacatgaagcct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agagaagctgaggctcaaagcac 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroadenosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaaagcactttattgagttcctg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acagctttgtacttatgctcctt 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythymidine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct actttcactttcttgggctccaa 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agaatcgaaagtgttgactccaa 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agccacatcggtgtagacgcctg 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agccacatcggtgtagacgcctg 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aagacagactcttgcggagccgc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acctgaaggcgcaacagagccag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggcagtgggcatcaggaccctt 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agtggaatcgaaagtgttgactc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agtggaatcgaaagtgttgactc 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accggctgaacgtaaggcgacag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accggctgaacgtaaggcgacag 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accggtgacagtgagaacgactg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agcgggtcatcgaagacagactc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acgacgcgggtcatcgaagacag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agggcatcaggacccttgcactg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atggcttgttgcggtcaccacag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acatcctcctgaaggcgcaacag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acatcctcctgaaggcgcaacag 23 RNA PAT modified_base 7 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agctcttcagctttgtacttatg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agctcttcagctttgtacttatg 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acagtacagcgcggcgatgtagg 23 RNA PAT modified_base 2 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atcccggatccaggccaggtagt 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acggatccaggccaggtagtagg 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggtggaatcgaaagtgttgact 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agatgatgccttgcagggtgagc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct attggcaggcacaccggctgaac 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atgccgtccgcatcctcctgaag 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aagggaaagatgagtccctgagc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acgaagacagactcttgcggagc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct actgaacgtaaggcgacaggagc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaccggctgaacgtaaggcgaca 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atgaggtgttgtggacagagaca 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acctcctgaaggcgcaacagagc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agaacgactgtgtgctcttcagc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaccggagaagctgaggctcaaa 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agtcgcagtactcccagctcagc 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroadenosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythymidine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aagctgagcccgcggccatcata 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accagctgatgatgccttgcagg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accagctgatgatgccttgcagg 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atgggcatcaggacccttgcact 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atcaggacccttgcactggcatc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agcagcagagccctcatggcatc 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acgcatcctcctgaaggcgcaac 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agaaagatgagtccctgagcaat 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agaaagatgagtccctgagcaat 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaatcgaaagtgttgactccaag 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acttgcactggcatctggccaca 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accaggccaggtagtaggccaca 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct actgaaggcgcaacagagccagg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct actggcttgttgcggtcaccaca 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agtgggtacatttgtggtacagc 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroadenosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythymidine -3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaggtgttgtggacagagacagt 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atgcactggcatctggccacagc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 7 mod_base OTHER note Adenosine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggcacaccggctgaacgtaagg 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluoroguanosine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agggcatgagtgggacatgaagc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acaacgacgcgggtcatcgaaga 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accggagaagctgaggctcaaag 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine-3'-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note Thymidine-glycol nucleic acid (GNA) S-Isomer modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct attcactttcttgggctccaaac 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aatcgaaagtgttgactccaagc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acggagaagctgaggctcaaagc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agagaacgactgtgtgctcttct 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acattttcaaagcactttattct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accagtacagcgcggcgatgtct 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acagagccaggtcgtgctggtct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct actgatgatgccttgcagggtct 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agacgcctggcttgttgcggtct 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accggatccaggccaggtagtct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaagatgagtccctgagcaatct 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agagggaaagatgagtccctgct 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accttgtgggtacatttgtggct 23 RNA PAT modified_base 2 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atcgaagacagactcttgcggct 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atgtcgttgtccgggttccggct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agctgaacgtaaggcgacaggct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acaccggctgaacgtaaggcgct 23 RNA PAT modified_base 2 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atccggaatcaccctggcacgct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acccggatccaggccaggtagct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agggaaagatgagtccctgagct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaacgacgcgggtcatcgaagct 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aagaacgactgtgtgctcttcct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaaccggagaagctgaggctcct 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acccttgcactggcatctggcct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aacaccggctgaacgtaaggcct 23 RNA PAT modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aactttattgagttcctgcgcct 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accgcatcctcctgaaggcgcct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aggaaagatgagtccctgagcct 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acgaggaaccctgcgcagagcct 23 RNA PAT modified_base 2 mod_base OTHER note thymine modified_base 5 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxythimidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct atcctgaaggcgcaacagagcct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agagaagctgaggctcaaagcct 23 RNA PAT modified_base 5 mod_base OTHER note thymine modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agaatcgaaagtgttgactccct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acctgaaggcgcaacagagccct 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accggctgaacgtaaggcgacct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acgacgcgggtcatcgaagacct 23 RNA PAT modified_base 7 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acatcctcctgaaggcgcaacct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaccggctgaacgtaaggcgact 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxycytidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaccggagaagctgaggctcact 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acgcatcctcctgaaggcgcact 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyguanosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct agaaagatgagtccctgagcact 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxyadenosine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine -3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct aaatcgaaagtgttgactccact 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accaggccaggtagtaggccact 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxycytidine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyadenosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acaacgacgcgggtcatcgaact 23 RNA PAT modified_base 12 mod_base OTHER note thymine misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'- phosphorothioate modified_base 2 mod_base OTHER note 2`-deoxycytidine-3`-phosphorothioate modified_base 5 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 7 mod_base OTHER note 2`-deoxyguanosine-3`-phosphate modified_base 12 mod_base OTHER note 2`-deoxythimidine-3`-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'- phosphorothioate source 1..23 mol_type other RNA organism synthetic construct accggagaagctgaggctcaact 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine -3'-phosphorothioate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate source 1..23 mol_type other RNA organism synthetic construct tttcaaagcactttattgagttc 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine -3'-phosphorothioate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate source 1..23 mol_type other RNA organism synthetic construct attttcaaagcactttattgagt 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorouridine -3'-phosphorothioate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate source 1..23 mol_type other RNA organism synthetic construct ttttcaaagcactttattgagtt 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine -3'-phosphorothioate modified_base 14 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluoroguanosine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylcytidine-3'-phosphorothioate source 1..23 mol_type other RNA organism synthetic construct tcaaagcactttattgagttcct 23 RNA PAT misc_feature 1..23 note Synthetic modified_base 1 mod_base OTHER note 2'-O-methyladenosine-3'-phosphorothioate modified_base 2 mod_base OTHER note 2'-fluorocytidine -3'-phosphorothioate modified_base 6 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 8 mod_base OTHER note 2'-fluorocytidine-3'-phosphate modified_base 9 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 14 mod_base OTHER note 2'-fluoroadenosine-3'-phosphate modified_base 16 mod_base OTHER note 2'-fluorouridine-3'-phosphate modified_base 21 mod_base OTHER note 2'-O-methyluridine-3'-phosphorothioate modified_base 22 mod_base OTHER note 2'-O-methylguanosine-3'-phosphorothioate source 1..23 mol_type other RNA organism synthetic construct acgttttcaaagcactttattga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agaaagagaagtgctttgagcct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acaaatgtacccacaagggccgg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ggaacccggacaacgacatccgc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ggaactcaataaagtgctttgaa 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agaactgagcaagcagctgtggc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acaagaatgagatatggtataga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgaagagcacacagtcgttctca 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gcaagcagctgtggccagatgcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gcaagctgctatgatggccgcgg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ataagtacaaagctgaagagcac 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agaagtgctttgagcctcagctt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tcaataaagtgctttgaaaatgc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ccacaaatgtacccacaagggcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gcacacagtcgttctcactgtca 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctacaccgatgtggcctactacc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct caacactttcgattccaccttgg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct caacactttcgattccaccttgg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acacagtcgttctcactgtcacc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctacatcgccgcgctgtactggg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctaccagcacgacctggctctgt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gaacccggacaacgacatccgcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tcaccctgcaaggcatcatcagc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgaccgcaacaagccaggcgtct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cgacctggctctgttgcgccttc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ttacgttcagccggtgtgcctgc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctactacctggcctggatccggg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gaactcaataaagtgctttgaaa 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gaactgagcaagcagctgtggcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaagagaagtgctttgagcctca 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gaagagcacacagtcgttctcac 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct caagagtctgtcttcgatgaccc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ccagatgccagtgcaagggtcct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ccagcacgacctggctctgttgc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct caagccaggcgtctacaccgatg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct caagccaggcgtctacaccgatg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ggagcccaagaaagtgaaagacc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaagctgaagagcacacagtcgt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct caagctgctatgatggccgcggg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gcagctgtaccacaaatgtaccc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct caaggagcataagtacaaagctg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct caaggagcataagtacaaagctg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ccaggatggcgcaggaactcaat 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ccaggcgtctacaccgatgtggc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctaggcttcatgtcccactcatg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ggagtcaacactttcgattccac 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ggagtcaacactttcgattccac 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct caataaagtgctttgaaaatgct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct acatccgcccgtggtgcttcgtg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ggatcgggctgtggtgaccgcaa 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agatgccagtgcaagggtcctga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gcatgctctgcgcagggttcctc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaatgtacccacaagggccggcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgattgctcagggactcatcttt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tacaaagctgaagagcacacagt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cacaaatgtacccacaagggccg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cccaagaaagtgaaagaccactg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cgcaagagtctgtcttcgatgac 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cccaaggagcataagtacaaagc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accacaaatgtacccacaagggc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctcaccctgcaaggcatcatcag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tacaccgatgtggcctactacct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcacgacctggctctgttgcgc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cccactgtctctgtccacaacac 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aacactttcgattccaccttggg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gccagatgccagtgcaagggtcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accagcacgacctggctctgttg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ggcagctgtaccacaaatgtacc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcagctgtggccagatgccagt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cgcaggaactcaataaagtgctt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gccaggatggcgcaggaactcaa 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gccaggcgtctacaccgatgtgg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctcagggactcatctttccctcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gccagtgcaagggtcctgatgcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct taccacaaatgtacccacaaggg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct taccacaaatgtacccacaaggg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ggccagatgccagtgcaagggtc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agccaggcgtctacaccgatgtg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcccaagaaagtgaaagaccac 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aacccggacaacgacatccgccc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aacccggacaacgacatccgccc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct caccctgcaaggcatcatcagct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct caccgatgtggcctactacctgg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gaccgcaacaagccaggcgtcta 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctccgcaagagtctgtcttcgat 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgccggaacccggacaacgacat 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgccggaacccggacaacgacat 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ttcctgcaggaggcgcaggtacc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctcctgtcgccttacgttcagcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctcctgtcgccttacgttcagcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cgccttacgttcagccggtgtgc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct accgcaacaagccaggcgtctac 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ggcgcaggaactcaataaagtgc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gtcgccttacgttcagccggtgt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cgcgctcctgtcgccttacgttc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gccggaacccggacaacgacatc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcggctccgcaagagtctgtct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ggcgtctacaccgatgtggccta 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgcgtgccagggtgattccggag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ccctacatcgccgcgctgtactg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tactacctggcctggatccggga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aactcaataaagtgctttgaaaa 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aactcaataaagtgctttgaaaa 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgctcagggactcatctttccct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cgctcctgtcgccttacgttcag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ggctctgttgcgccttcaggagg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agctgaagagcacacagtcgttc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tcctgattgctcagggactcatc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ccctgcaaggcatcatcagctgg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ttctgccggaacccggacaacga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agctgtaccacaaatgtacccac 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tcctgtcgccttacgttcagccg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cactgtctctgtccacaacacct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ggctgtggtgaccgcaacaagcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gccttacgttcagccggtgtgcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gtcttcgatgacccgcgtcgttg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agcttggagtcaacactttcgat 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgctttgagcctcagcttctccg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagaaagtgaaagaccactgcag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cggaacccggacaacgacatccg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggaactcaataaagtgctttga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctgaagagcacacagtcgttctc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gtgaccgcaacaagccaggcgtc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagagcacacagtcgttctcact 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggagcataagtacaaagctgaa 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ttgagcctcagcttctccggttt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagagtctgtcttcgatgacccg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cagatgccagtgcaagggtcctg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggatggcgcaggaactcaataa 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctgattgctcagggactcatctt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ccgcaagagtctgtcttcgatga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gagcacacagtcgttctcactgt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cagcacgacctggctctgttgcg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cagcacgacctggctctgttgcg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagcagctgtggccagatgccag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gcgcaggaactcaataaagtgct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tggccagatgccagtgcaagggt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagccaggcgtctacaccgatgt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gagcccaagaaagtgaaagacca 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tcgccttacgttcagccggtgtg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tggcgcaggaactcaataaagtg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ttgcgccttcaggaggatgcgga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cagcggctccgcaagagtctgtc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ttgctcagggactcatctttccc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cggctccgcaagagtctgtcttc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gcgctcctgtcgccttacgttca 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgctctgcgcagggttcctcga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgctctgcgcagggttcctcga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tggctctgttgcgccttcaggag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tggctctgttgcgccttcaggag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagctgaagagcacacagtcgtt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagctgctatgatggccgcgggc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ccgctggtgtgtgaggaccaagc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gggctgtggtgaccgcaacaagc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gggctgtggtgaccgcaacaagc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggcttcatgtcccactcatgcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gtgctttgagcctcagcttctcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct caggaactcaataaagtgctttg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aaggagcataagtacaaagctga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ttggagcccaagaaagtgaaaga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ttggagtcaacactttcgattcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct caggcgtctacaccgatgtggcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct caggcgtctacaccgatgtggcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gcggctccgcaagagtctgtctt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctggctctgttgcgccttcagga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aagggtcctgatgcccactgcca 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gagtcaacactttcgattccacc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gagtcaacactttcgattccacc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctgtcgccttacgttcagccggt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctgtcgccttacgttcagccggt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cagtcgttctcactgtcaccggg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gagtctgtcttcgatgacccgcg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctgtcttcgatgacccgcgtcgt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cagtgcaagggtcctgatgccca 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctgtggtgaccgcaacaagccag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctgttgcgccttcaggaggatgc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctgttgcgccttcaggaggatgc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cataagtacaaagctgaagagca 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cataagtacaaagctgaagagca 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cctacatcgccgcgctgtactgg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct actacctggcctggatccgggag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cctactacctggcctggatccgg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agtcaacactttcgattccacct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gctcaccctgcaaggcatcatca 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gttcagccggtgtgcctgccaag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cttcaggaggatgcggacggcag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gctcagggactcatctttccctc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gctccgcaagagtctgtcttcga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gctcctgtcgccttacgttcagc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgtcgccttacgttcagccggtg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgtctctgtccacaacacctcac 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gctctgttgcgccttcaggagga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gctgaagagcacacagtcgttct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tttgagcctcagcttctccggtt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gctgagctgggagtactgcgacc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tatgatggccgcgggctcagcta 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cctgcaaggcatcatcagctggg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cctgcaaggcatcatcagctggg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct agtgcaagggtcctgatgcccac 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gatgccagtgcaagggtcctgat 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gatgccatgagggctctgctgct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gttgcgccttcaggaggatgcgg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct attgctcagggactcatctttcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct attgctcagggactcatctttcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cttggagtcaacactttcgattc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgtggccagatgccagtgcaagg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgtggcctactacctggcctgga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cctggctctgttgcgccttcagg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgtggtgaccgcaacaagccagg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gctgtaccacaaatgtacccaca 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct actgtctctgtccacaacacctc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gctgtggccagatgccagtgcaa 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ccttacgttcagccggtgtgcct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gcttcatgtcccactcatgcccg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tcttcgatgacccgcgtcgttgg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctttgagcctcagcttctccggt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gtttggagcccaagaaagtgaaa 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gcttggagtcaacactttcgatt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gctttgagcctcagcttctccgg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgaagagcacacagtcgttctca 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tcaataaagtgctttgaaaatgc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctacatcgccgcgctgtactggg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctaccagcacgacctggctctgt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tcaccctgcaaggcatcatcagc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgaccgcaacaagccaggcgtct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctactacctggcctggatccggg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgattgctcagggactcatcttt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctcagggactcatctttccctcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct taccacaaatgtacccacaaggg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctccgcaagagtctgtcttcgat 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgccggaacccggacaacgacat 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctcctgtcgccttacgttcagcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gtcgccttacgttcagccggtgt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgcgtgccagggtgattccggag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tactacctggcctggatccggga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgctcagggactcatctttccct 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gtcttcgatgacccgcgtcgttg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctgaagagcacacagtcgttctc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ttgagcctcagcttctccggttt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tggccagatgccagtgcaagggt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tcgccttacgttcagccggtgtg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tggcgcaggaactcaataaagtg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ttgcgccttcaggaggatgcgga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ttgctcagggactcatctttccc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct atgctctgcgcagggttcctcga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tggctctgttgcgccttcaggag 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gtgctttgagcctcagcttctcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ttggagtcaacactttcgattcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctggctctgttgcgccttcagga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctgtcgccttacgttcagccggt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctgtcttcgatgacccgcgtcgt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctgttgcgccttcaggaggatgc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgtcgccttacgttcagccggtg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tttgagcctcagcttctccggtt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gttgcgccttcaggaggatgcgg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct attgctcagggactcatctttcc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct cttggagtcaacactttcgattc 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tgtggcctactacctggcctgga 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct tcttcgatgacccgcgtcgttgg 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct ctttgagcctcagcttctccggt 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct gaactcaataaagtgctttgaaa 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct actcaataaagtgctttgaaaat 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aactcaataaagtgctttgaaaa 23 RNA PAT misc_feature 1..23 note Synthetic source 1..23 mol_type other RNA organism synthetic construct aggaactcaataaagtgctttga 20 RNA PAT misc_feature 1..20 note Synthetic source 1..20 mol_type other RNA organism synthetic construct modified_base 5 mod_base OTHER note thymine modified_base 10 mod_base OTHER note thymine modified_base 13..15 mod_base OTHER note thymine tcaataaagtgctttgaaaa