WO BP303147PC EP EP21208495.8 2021-11-16 Probitat Oy BACTERIAL STRAIN AND THE USE THEREOF 5 10 DNA PAT misc_feature 1..10 note primer P2 source 1..10 mol_type other DNA organism synthetic construct gatcggacgg 10 DNA PAT misc_feature 1..10 note primer P16 source 1..10 mol_type other DNA organism synthetic construct tcgccagcca 10 DNA PAT misc_feature 1..10 note Primer P17 source 1..10 mol_type other DNA organism synthetic construct cagacaagcc 20 DNA PAT misc_feature 1..20 note Primer 27f source 1..20 mol_type other DNA organism synthetic construct agagtttgatcctggctcag 20 DNA PAT misc_feature 1..20 note Primer 685r source 1..20 mol_type other DNA organism synthetic construct tctacgcatttcaccgctac