WO 129293.021501 US 63/546,215 2023-10-29 Corsera LLC Victor Kotelianski IMPROVED SIRNA FOR SILENCING EXPRESSION OF PCSK9 AND USES THEREOF 124 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 2..6 mod_base OTHER note Uracil modified_base 16..19 mod_base OTHER note Uracil ctttttacagccaacttttca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note Uracil modified_base 8..9 mod_base OTHER note Uracil modified_base 13 mod_base OTHER note Uracil modified_base 15 mod_base OTHER note Uracil tgaaaagttggctgtaaaaaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 2..6 mod_base OTHER note Uracil modified_base 16..19 mod_base OTHER note Uracil modified_base 21 mod_base OTHER note Uracil ctttttacagccaacttttct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 8..9 mod_base OTHER note Uracil modified_base 13 mod_base OTHER note Uracil modified_base 15 mod_base OTHER note Uracil agaaaagttggctgtaaaaaggc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 2..5 mod_base OTHER note Uracil modified_base 7 mod_base OTHER note Uracil modified_base 11..12 mod_base OTHER note Uracil modified_base 18 mod_base OTHER note Uracil modified_base 20 mod_base OTHER note Uracil cttttgtaacttgaagatata 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note Uracil modified_base 3 mod_base OTHER note Uracil modified_base 5 mod_base OTHER note Uracil modified_base 7..8 mod_base OTHER note Uracil modified_base 13..14 mod_base OTHER note Uracil tatatcttcaagttacaaaagca 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct modified_base 2 mod_base OTHER note Uracil modified_base 8 mod_base OTHER note Uracil modified_base 10 mod_base OTHER note Uracil modified_base 12..13 mod_base OTHER note Uracil modified_base 16..19 mod_base OTHER note Uracil ctagacctgttttgcttttga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note Uracil modified_base 17 mod_base OTHER note Uracil modified_base 19 mod_base OTHER note Uracil tcaaaagcaaaacaggtctagaa 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyladenine-3-phosphorothioate modified_base 4 mod_base OTHER note 2-O-methylguanine modified_base 5 mod_base OTHER note 2-O-methyladenine modified_base 6 mod_base OTHER note 2-O-methylcytosine modified_base 7 mod_base OTHER note 2-fluorocytosine modified_base 8 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-fluoroguanine modified_base 10 mod_base OTHER note 2-O-methyluracil modified_base 11 mod_base OTHER note deoxythymine modified_base 12..13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-O-methylguanine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylguanine modified_base 21 mod_base OTHER note 2-O-methyluracil modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnngacntntnttgcttttgtn 000 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyladenine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyladenine modified_base 4 mod_base OTHER note 2-O-methylguanine modified_base 5 mod_base OTHER note 2-O-methyladenine modified_base 6 mod_base OTHER note 2-O-methylcytosine modified_base 7 mod_base OTHER note 2-fluoroguanine modified_base 8 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-fluoroguanine modified_base 10 mod_base OTHER note 2-O-methyluracil modified_base 11 mod_base OTHER note deoxythymine modified_base 12..13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-O-methylguanine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylguanine modified_base 21 mod_base OTHER note 2-O-methylguanine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnagacntntnttgcttttgtn 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluorocytisine-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyladenine modified_base 4..6 mod_base OTHER note 2-fluoroadenine modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 8 mod_base OTHER note 2-fluorocytosine modified_base 9 mod_base OTHER note 2-O-methyladenine modified_base 10 mod_base OTHER note 2-fluoroadenine modified_base 11 mod_base OTHER note 2-O-methyladenine modified_base 12 mod_base OTHER note 2-fluoroadenine modified_base 13 mod_base OTHER note 2-O-methylcytosine modified_base 14 mod_base OTHER note 2-fluoroadenine modified_base 15 mod_base OTHER note 2-O-methylguanine modified_base 16 mod_base OTHER note 2-fluoroguanine modified_base 17 mod_base OTHER note 2-O-methyluracil modified_base 18 mod_base OTHER note 2-fluorocytosine modified_base 19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methyladenine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nnannngnanancngntntanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyladenine modified_base 14 mod_base OTHER note 2-O-methylguanine modified_base 3 mod_base OTHER note 2-O-methyladenine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 7 mod_base OTHER note 2-fluorocytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-fluoroguanine modified_base 10..11 mod_base OTHER note 2-fluorouracil modified_base 8 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylguanine modified_base 6 mod_base OTHER note 2-O-methylcytosine modified_base 12..13 mod_base OTHER note 2-O-methyluracil modified_base 4 mod_base OTHER note 2-O-methylguanine modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnagacntnnnttgcttttgan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluorocytisine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluorocytisine-3-phosphorothioate modified_base 6 mod_base OTHER note 2-fluoroadenine modified_base 15 mod_base OTHER note 2-O-methylguanine modified_base 8 mod_base OTHER note 2-fluorocytosine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 3..5 mod_base OTHER note 2-O-methyladenine modified_base 13 mod_base OTHER note 2-O-methylcytosine modified_base 14 mod_base OTHER note 2-fluoroadenine modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 16 mod_base OTHER note 2-fluoroguanine modified_base 17 mod_base OTHER note 2-O-methyluracil modified_base 18 mod_base OTHER note 2-O-methylcytosine modified_base 19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methyladenine-3-phosphorothioate modified_base 10..12 mod_base OTHER note 2-O-methyladenine nnaaangnnaaacngntctanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyladenine modified_base 4 mod_base OTHER note 2-O-methylguanine modified_base 5 mod_base OTHER note 2-O-methyladenine modified_base 6 mod_base OTHER note 2-O-methylcytosine modified_base 7 mod_base OTHER note 2-fluorocytosine modified_base 8 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-fluoroguanine modified_base 10 mod_base OTHER note 2-fluorouracil modified_base 11 mod_base OTHER note deoxythymine modified_base 12..13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-O-methylguanine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylguanine modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnagacntnnnttgcttttgan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluorocytisine-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyladenine modified_base 6 mod_base OTHER note 2-fluoroadenine modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 8 mod_base OTHER note 2-O-methylcytosine modified_base 9..12 mod_base OTHER note 2-O-methyladenine modified_base 13 mod_base OTHER note 2-O-methylcytosine modified_base 14 mod_base OTHER note 2-fluoroadenine modified_base 15 mod_base OTHER note 2-O-methylguanine modified_base 16 mod_base OTHER note 2-fluoroguanine modified_base 17 mod_base OTHER note 2-O-methyluracil modified_base 18 mod_base OTHER note 2-O-methylcytosine modified_base 19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methyladenine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nnaaangcaaaacngntctanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyladenine modified_base 4 mod_base OTHER note 2-O-methylguanine modified_base 5 mod_base OTHER note 2-O-methyladenine modified_base 6 mod_base OTHER note 2-O-methylcytosine modified_base 7 mod_base OTHER note 2-fluorocytosine modified_base 8 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-fluoroguanine modified_base 10 mod_base OTHER note 2-fluorouracil modified_base 11 mod_base OTHER note deoxythymine modified_base 12..13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-O-methylguanine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylguanine modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnagacntnnnttgcttttgan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluorocytisine-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyladenine modified_base 6 mod_base OTHER note GNA-G modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 8 mod_base OTHER note 2-O-methylcytosine modified_base 9..12 mod_base OTHER note 2-O-methyladenine modified_base 13 mod_base OTHER note 2-O-methylcytosine modified_base 14 mod_base OTHER note 2-fluoroadenine modified_base 15 mod_base OTHER note 2-O-methylguanine modified_base 16 mod_base OTHER note 2-fluoroguanine modified_base 17 mod_base OTHER note 2-O-methyluracil modified_base 18 mod_base OTHER note 2-O-methylcytosine modified_base 19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methyladenine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nnaaanncaaaacngntctanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyladenine modified_base 4 mod_base OTHER note 2-O-methylguanine modified_base 5 mod_base OTHER note 2-O-methyladenine modified_base 6 mod_base OTHER note 2-O-methylcytosine modified_base 7 mod_base OTHER note 2-fluorocytosine modified_base 8 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-fluoroguanine modified_base 10 mod_base OTHER note 2-fluorouracil modified_base 11 mod_base OTHER note deoxythymine modified_base 12..13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-O-methylguanine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylguanine modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnagacntnnnttgcttttgan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluorocytisine-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyladenine modified_base 6 mod_base OTHER note 2-fluoroadenine modified_base 7 mod_base OTHER note GNA-G modified_base 8 mod_base OTHER note 2-O-methylcytosine modified_base 9..12 mod_base OTHER note 2-O-methyladenine modified_base 13 mod_base OTHER note 2-O-methylcytosine modified_base 14 mod_base OTHER note 2-fluoroadenine modified_base 15 mod_base OTHER note 2-O-methylguanine modified_base 16 mod_base OTHER note 2-fluoroguanine modified_base 17 mod_base OTHER note 2-O-methyluracil modified_base 18 mod_base OTHER note 2-O-methylcytosine modified_base 19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methyladenine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nnaaanncaaaacngntctanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..6 mod_base OTHER note 2-O-methyluracil modified_base 7 mod_base OTHER note 2-fluoroadenine modified_base 8 mod_base OTHER note 2-O-methylcytosine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluoroguanine modified_base 11 mod_base OTHER note 2-fluorocytosine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13..14 mod_base OTHER note 2-O-methyladenine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylcytosine modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnttttncnnncaacttttcan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroguanine-3-phosphorothioate modified_base 3..6 mod_base OTHER note 2-O-methyladenine modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 8..9 mod_base OTHER note 2-O-methyluracil modified_base 10..11 mod_base OTHER note 2-O-methylguanine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluoroguanine modified_base 15 mod_base OTHER note 2-O-methyluracil modified_base 16 mod_base OTHER note 2-fluoroadenine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21..22 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methylcytosine nnaaanncaaaacngntctanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..6 mod_base OTHER note 2-O-methyluracil modified_base 7 mod_base OTHER note 2-fluoroadenine modified_base 8 mod_base OTHER note 2-O-methylcytosine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluoroguanine modified_base 11 mod_base OTHER note 2-fluorocytosine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13..14 mod_base OTHER note 2-O-methyladenine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylcytosine modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnttttncnnncaacttttcan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroguanine-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyladenine modified_base 6 mod_base OTHER note GNA-A modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 8..9 mod_base OTHER note 2-O-methyluracil modified_base 10..11 mod_base OTHER note 2-O-methylguanine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluoroguanine modified_base 15 mod_base OTHER note 2-O-methyluracil modified_base 16 mod_base OTHER note 2-fluoroadenine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21..22 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methylcytosine nnaaangttggctntnaaaannc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..6 mod_base OTHER note 2-O-methyluracil modified_base 7 mod_base OTHER note 2-fluoroadenine modified_base 8 mod_base OTHER note 2-O-methylcytosine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluoroguanine modified_base 11 mod_base OTHER note 2-fluorocytosine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13..14 mod_base OTHER note 2-O-methyladenine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylcytosine modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnttttncnnncaacttttcan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroguanine-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyladenine modified_base 6 mod_base OTHER note GNA-G modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 8..9 mod_base OTHER note 2-O-methyluracil modified_base 10..11 mod_base OTHER note 2-O-methylguanine modified_base 13 mod_base OTHER note 2-O-methylcytosine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluoroguanine modified_base 15 mod_base OTHER note 2-O-methyluracil modified_base 16 mod_base OTHER note 2-fluoroadenine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21..22 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methylcytosine nnaaangttggctntnaaaannc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..6 mod_base OTHER note 2-O-methyluracil modified_base 7 mod_base OTHER note 2-fluoroadenine modified_base 8 mod_base OTHER note 2-O-methylcytosine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluoroguanine modified_base 11 mod_base OTHER note 2-fluorocytosine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13..14 mod_base OTHER note 2-O-methyladenine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylcytosine modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnttttncnnncaacttttcan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroguanine-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyladenine modified_base 6 mod_base OTHER note 2-fluoroadenine modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 8..9 mod_base OTHER note 2-fluorouracil modified_base 10..11 mod_base OTHER note 2-O-methylguanine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluoroguanine modified_base 15 mod_base OTHER note 2-O-methyluracil modified_base 16 mod_base OTHER note 2-fluoroadenine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21..22 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methylcytosine nnaaangnnggctntnaaaannc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..6 mod_base OTHER note 2-O-methyluracil modified_base 7 mod_base OTHER note Adenine 2-4-Locked Nucleic Acid modified_base 8 mod_base OTHER note 2-O-methylcytosine modified_base 8 mod_base OTHER note 2-fluoroadenine modified_base 9 mod_base OTHER note Guanine 2-4-Locked Nucleic Acid modified_base 11 mod_base OTHER note 2-fluorocytosine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13..14 mod_base OTHER note 2-O-methyladenine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylcytosine modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand modified_base 10 mod_base OTHER note 2-fluorocytosine nnttttncnnncaacttttcan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroguanine-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyladenine modified_base 6 mod_base OTHER note 2-fluoroadenine modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 8..9 mod_base OTHER note 2-O-methyluracil modified_base 10..11 mod_base OTHER note 2-O-methylguanine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluoroguanine modified_base 15 mod_base OTHER note 2-O-methyluracil modified_base 16 mod_base OTHER note 2-fluoradenine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21..22 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methylcytosine nnaaaagttggctntnaaaannc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..6 mod_base OTHER note 2-O-methyluracil modified_base 7 mod_base OTHER note 2-fluoroadenine modified_base 8 mod_base OTHER note 2-O-methylcytosine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluoroguanine modified_base 11 mod_base OTHER note 1-H (no base) modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13..14 mod_base OTHER note 2-O-methyladenine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylcytosine modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnttttncnnncaacttttcan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroguanine-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyladenine modified_base 6 mod_base OTHER note 2-fluoroadenine modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 8..9 mod_base OTHER note 2-O-methyluracil modified_base 10..11 mod_base OTHER note 2-O-methylguanine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluoroguanine modified_base 15 mod_base OTHER note 2-O-methyluracil modified_base 16 mod_base OTHER note 2-fluoroadenine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21..22 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methylcytosine nnaaaagttggctntnaaaannc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..6 mod_base OTHER note 2-O-methyluracil modified_base 7 mod_base OTHER note 2-fluoroadenine modified_base 8 mod_base OTHER note 2-O-methylcytosine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluoroguanine modified_base 11 mod_base OTHER note 2-fluorocytosine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13..14 mod_base OTHER note 2-O-methyladenine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylcytosine modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnttttncnnncaacttttcan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroguanine-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyladenine modified_base 6 mod_base OTHER note 2-fluoroadenine modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 8..9 mod_base OTHER note 2-O-fluorouracil modified_base 10..11 mod_base OTHER note 2-O-methylguanine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluoroguanine modified_base 15 mod_base OTHER note 2-O-methyluracil modified_base 16 mod_base OTHER note 2-fluoroadenine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21..22 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methylcytosine nnaaaagttggctntnaaaannc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..6 mod_base OTHER note 2-O-methyluracil modified_base 7 mod_base OTHER note 2-fluoroadenine modified_base 8 mod_base OTHER note 2-O-methylcytosine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluoroguanine modified_base 11 mod_base OTHER note 2-fluorocytosine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13..14 mod_base OTHER note 2-O-methyladenine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylcytosine modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnttttncnnncaacttttcan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroguanine-3-phosphorothioate modified_base 3..6 mod_base OTHER note 2-O-methyladenine modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 8..9 mod_base OTHER note 2-O-methyluracil modified_base 10..11 mod_base OTHER note 2-O-methylguanine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluoroguanine modified_base 15 mod_base OTHER note 2-O-methyluracil modified_base 16 mod_base OTHER note Adenine 2-4-Locked Nucleic Acid modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21..22 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methylcytosine nnaaaagttggctntnaaaannc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..6 mod_base OTHER note 2-O-methyluracil modified_base 7 mod_base OTHER note 2-fluoroadenine modified_base 8 mod_base OTHER note 2-O-methylcytosine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluoroguanine modified_base 11 mod_base OTHER note deoxycytosine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13..14 mod_base OTHER note 2-O-methyladenine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylcytosine modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnttttncnnncaacttttcan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyldenosine modified_base 6 mod_base OTHER note 2-fluoroadenine modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 8..9 mod_base OTHER note 2-O-methyluracil modified_base 10..11 mod_base OTHER note 2-O-methylguanine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluoroguanine modified_base 15 mod_base OTHER note 2-O-methyluracil modified_base 16 mod_base OTHER note 2-fluoroadenine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nntatnttcaagtnanaaaanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..6 mod_base OTHER note 2-O-methyluracil modified_base 7 mod_base OTHER note 2-fluoroadenine modified_base 8 mod_base OTHER note 2-O-methylcytosine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluoroguanine modified_base 11 mod_base OTHER note 2-fluorocytosine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13..14 mod_base OTHER note 2-O-methyladenine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylcytosine modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnttttncnnncaacttttcan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 3..6 mod_base OTHER note 2-O-methyldenosine modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 8..9 mod_base OTHER note 2-O-methyluracil modified_base 10..11 mod_base OTHER note 2-O-methylguanine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note Guanine 2-4-Locked Nucleic Acid modified_base 15 mod_base OTHER note 2-O-methyluracil modified_base 16 mod_base OTHER note Adenine 2-4-Locked Nucleic Acid modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nntatnttcaagtnanaaaanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..6 mod_base OTHER note 2-O-methyluracil modified_base 7 mod_base OTHER note 2-fluoroadenine modified_base 8 mod_base OTHER note 2-O-methylcytosine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluoroguanine modified_base 11 mod_base OTHER note 2-fluorocytosine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13..14 mod_base OTHER note 2-O-methyladenine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylcytosine modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnttttncnnncaacttttcan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroguanine-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyladenine modified_base 6 mod_base OTHER note 2-fluoroadenine modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 8..9 mod_base OTHER note 2-fluorouracil modified_base 10..11 mod_base OTHER note 2-O-methylguanine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluoroguanine modified_base 15 mod_base OTHER note 2-O-methyluracil modified_base 16 mod_base OTHER note 2-fluoroadenine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nntatcntcaagtnanaaaanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..6 mod_base OTHER note 2-O-methyluracil modified_base 7 mod_base OTHER note 2-fluoroadenine modified_base 8 mod_base OTHER note 2-O-methylcytosine modified_base 9 mod_base OTHER note Adenine 2-4-Locked Nucleic Acid modified_base 10 mod_base OTHER note deoxyguanine modified_base 11 mod_base OTHER note Cytosine 2-4-Locked Nucleic Acid modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13..14 mod_base OTHER note 2-O-methyladenine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylcytosine modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnttttncnnncaacttttcan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyldenosine modified_base 6 mod_base OTHER note 2-fluoroadenine modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 8..9 mod_base OTHER note 2-O-methyluracil modified_base 10..11 mod_base OTHER note 2-O-methylguanine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluoroguanine modified_base 15 mod_base OTHER note 2-O-methyluracil modified_base 16 mod_base OTHER note 2-fluoroadenine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nntatnttcaagtnanaaaanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..6 mod_base OTHER note 2-O-methyluracil modified_base 7 mod_base OTHER note Adenine 2-4-Locked Nucleic Acid modified_base 8 mod_base OTHER note 2-O-methylcytosine modified_base 9 mod_base OTHER note deoxyadenosine modified_base 10 mod_base OTHER note Guanine 2-4-Locked Nucleic Acid modified_base 11 mod_base OTHER note deoxycytosine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13..14 mod_base OTHER note 2-O-methyladenine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylcytosine modified_base 21 mod_base OTHER note 2-O-methylcytosine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnttttncnnncaacttttcan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyldenosine modified_base 6 mod_base OTHER note 2-fluoroadenine modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 8..9 mod_base OTHER note 2-O-methyluracil modified_base 10..11 mod_base OTHER note 2-O-methylguanine modified_base 12 mod_base OTHER note 2-O-methylcytosine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluoroguanine modified_base 15 mod_base OTHER note 2-O-methyluracil modified_base 16 mod_base OTHER note 2-fluoroadenine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nntatnttcaagtnanaaaanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-O-methylguanine modified_base 7 mod_base OTHER note 2-fluorouracil modified_base 8 mod_base OTHER note 2-O-methyladenine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluorocytosine modified_base 11 mod_base OTHER note 2-fluorouracil modified_base 12 mod_base OTHER note 2-O-methyluracil modified_base 13 mod_base OTHER note 2-O-methylguanine modified_base 14..15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-O-methylguanine modified_base 17 mod_base OTHER note 2-O-methyladenine modified_base 20 mod_base OTHER note 2-O-methyluracil modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand modified_base 18 mod_base OTHER note 2-O-methylguanine modified_base 19 mod_base OTHER note 2-O-methyladenine nntttgnannntgaagatatan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyluracil modified_base 4 mod_base OTHER note 2-O-methyladenine modified_base 5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-O-methylcytosine modified_base 7..8 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-O-methylcytosine modified_base 10..11 mod_base OTHER note 2-O-methyladenine modified_base 12 mod_base OTHER note 2-O-methyladenine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluorouracil modified_base 15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note Cytosine 2-4-Locked Nucleic Acid modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nntatcttcaagtnanaaaanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-O-methylguanine modified_base 7 mod_base OTHER note 2-fluorouracil modified_base 8 mod_base OTHER note 2-O-methyladenine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluorocytosine modified_base 11 mod_base OTHER note 2-fluorouracil modified_base 12 mod_base OTHER note 2-O-methyluracil modified_base 13 mod_base OTHER note 2-O-methylguanine modified_base 14..15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-O-methylguanine modified_base 17 mod_base OTHER note 2-O-methyladenine modified_base 20 mod_base OTHER note 2-O-methyluracil modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand modified_base 18 mod_base OTHER note 2-O-methylguanine modified_base 19 mod_base OTHER note 2-O-methyladenine nntttgnannntgaagatatan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyluracil modified_base 4 mod_base OTHER note 2-O-methyladenine modified_base 5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note deoxycytosine modified_base 7..8 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-O-methylcytosine modified_base 10..11 mod_base OTHER note 2-O-methyladenine modified_base 12 mod_base OTHER note 2-O-methylguanine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluorouracil modified_base 15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-fluorocytosine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nntatnttcaagtnanaaaanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-O-methylguanine modified_base 7 mod_base OTHER note 2-fluorouracil modified_base 8 mod_base OTHER note 2-O-methyladenine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluorocytosine modified_base 11 mod_base OTHER note 2-fluorouracil modified_base 12 mod_base OTHER note 2-O-methyluracil modified_base 13 mod_base OTHER note 2-O-methylguanine modified_base 14..15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-O-methylguanine modified_base 17 mod_base OTHER note 2-O-methyladenine modified_base 20 mod_base OTHER note 2-O-methyluracil modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand modified_base 18 mod_base OTHER note 2-O-methylguanine modified_base 19 mod_base OTHER note 2-O-methyladenine nntttgnannntgaagatatan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyluracil modified_base 4 mod_base OTHER note 2-O-methyladenine modified_base 5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note GNA-C modified_base 7..8 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-O-methylcytosine modified_base 10..11 mod_base OTHER note 2-O-methyladenine modified_base 12 mod_base OTHER note 2-O-methylguanine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluorouracil modified_base 15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-fluorocytosine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nntatnttcaagtnanaaaanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-O-methylguanine modified_base 7 mod_base OTHER note 2-fluorouracil modified_base 8 mod_base OTHER note 2-O-methyladenine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluorocytosine modified_base 11 mod_base OTHER note 2-fluorouracil modified_base 12 mod_base OTHER note 2-O-methyluracil modified_base 13 mod_base OTHER note 2-O-methylguanine modified_base 14..15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-O-methylguanine modified_base 17 mod_base OTHER note 2-O-methyladenine modified_base 20 mod_base OTHER note 2-O-methyluracil modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand modified_base 18 mod_base OTHER note 2-O-methylguanine modified_base 19 mod_base OTHER note 2-O-methyladenine nntttgnannntgaagatatan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyluracil modified_base 4 mod_base OTHER note 2-O-methyladenine modified_base 5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-O-methylcytosine modified_base 7 mod_base OTHER note GNA-U modified_base 8 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-O-methylcytosine modified_base 10..11 mod_base OTHER note 2-O-methyladenine modified_base 12 mod_base OTHER note 2-O-methylguanine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluorouracil modified_base 15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-fluorocytosine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nntatcntcaagtnanaaaanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-O-methylguanine modified_base 7 mod_base OTHER note 2-fluorouracil modified_base 8 mod_base OTHER note 2-O-methyladenine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluorocytosine modified_base 11 mod_base OTHER note 2-fluorouracil modified_base 12 mod_base OTHER note 2-O-methyluracil modified_base 13 mod_base OTHER note 2-O-methylguanine modified_base 14..15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-O-methylguanine modified_base 17 mod_base OTHER note 2-O-methyladenine modified_base 20 mod_base OTHER note 2-O-methyluracil modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand modified_base 18 mod_base OTHER note 2-O-methylguanine modified_base 19 mod_base OTHER note 2-O-methyladenine nntttgnannntgaagatatan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyluracil modified_base 4 mod_base OTHER note 2-O-methyladenine modified_base 5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-fluorocytosine modified_base 7 mod_base OTHER note 2-O-methyluracil modified_base 8 mod_base OTHER note 2-fluorouracil modified_base 9 mod_base OTHER note 2-fluorocytosine modified_base 10..11 mod_base OTHER note 2-O-methyladenine modified_base 12 mod_base OTHER note 2-O-methylguanine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluorouracil modified_base 15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-fluorocytosine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nntatntnnaagtnanaaaanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-O-methylguanine modified_base 7 mod_base OTHER note 2-fluorouracil modified_base 8 mod_base OTHER note 2-O-methyladenine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluorocytosine modified_base 11 mod_base OTHER note 2-fluorouracil modified_base 12 mod_base OTHER note 2-O-methyluracil modified_base 13 mod_base OTHER note 2-O-methylguanine modified_base 14..15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-O-methylguanine modified_base 17 mod_base OTHER note 2-O-methyladenine modified_base 20 mod_base OTHER note 2-O-methyluracil modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand modified_base 18 mod_base OTHER note 2-O-methylguanine modified_base 19 mod_base OTHER note 2-O-methyladenine nntttgnannntgaagatatan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyluracil modified_base 4 mod_base OTHER note 2-O-methyladenine modified_base 5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-O-methylcytosine modified_base 7..8 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-O-methylcytosine modified_base 10..11 mod_base OTHER note 2-O-methyladenine modified_base 12 mod_base OTHER note 2-O-methylguanine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluorouracil modified_base 15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-fluorocytosine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate nntatcttcaagtnanaaaannc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..6 mod_base OTHER note 2-O-methyluracil modified_base 7 mod_base OTHER note 2-fluoroadenine modified_base 8 mod_base OTHER note 2-O-methyldenosine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluorocytosine modified_base 11 mod_base OTHER note 1-H (no base) modified_base 12 mod_base OTHER note 2-O-methyluracil modified_base 13 mod_base OTHER note 2-O-methylguanine modified_base 14..15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-O-methylguanine modified_base 17 mod_base OTHER note 2-O-methyladenine modified_base 18 mod_base OTHER note 2-O-methyluracil modified_base 19 mod_base OTHER note 2-O-methyladenine modified_base 20 mod_base OTHER note 2-O-methyluracil modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nntttgnannntgaagatatan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyluracil modified_base 4 mod_base OTHER note 2-O-methyladenine modified_base 5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-flurocytosine modified_base 7..8 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-O-methylcytosine modified_base 10..11 mod_base OTHER note 2-O-methyladenine modified_base 12 mod_base OTHER note 2-O-methylguanine modified_base 12 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluorouracil modified_base 15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-fluorocytosine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nntatnttcaagtnanaaaanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-O-methylguanine modified_base 7 mod_base OTHER note deoxythymine 2-4-Locked Nucleic Acid modified_base 8 mod_base OTHER note 2-O-methyladenine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note Cytosine 2-4-Locked Nucleic Acid modified_base 11 mod_base OTHER note 2-fluorouracil modified_base 12 mod_base OTHER note 2-O-methyluracil modified_base 13 mod_base OTHER note 2-O-methylguanine modified_base 14..15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-O-methylguanine modified_base 17 mod_base OTHER note 2-O-methyladenine modified_base 18 mod_base OTHER note 2-O-methyluracil modified_base 19 mod_base OTHER note 2-O-methyladenine modified_base 20 mod_base OTHER note 2-O-methyluracil modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nntttgnannntgaagatatan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyluracil modified_base 4 mod_base OTHER note 2-O-methyladenine modified_base 5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-O-flurocytosine modified_base 7..8 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-O-methylcytosine modified_base 10..11 mod_base OTHER note 2-O-methyladenine modified_base 12 mod_base OTHER note 2-O-methylguanine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluorouracil modified_base 15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-fluorocytosine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nntatnttcaagtnanaaaanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-O-methylguanine modified_base 7 mod_base OTHER note deoxythymine 2-4-Locked Nucleic Acid modified_base 8 mod_base OTHER note 2-O-methyladenine modified_base 9 mod_base OTHER note deoxyadenosine modified_base 10 mod_base OTHER note Cytosine 2-4-Locked Nucleic Acid modified_base 11 mod_base OTHER note deoxythymine modified_base 12 mod_base OTHER note 2-O-methyluracil modified_base 13 mod_base OTHER note 2-O-methylguanine modified_base 14..15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-O-methylguanine modified_base 17 mod_base OTHER note 2-O-methyladenine modified_base 18 mod_base OTHER note 2-O-methyluracil modified_base 19 mod_base OTHER note 2-O-methyladenine modified_base 20 mod_base OTHER note 2-O-methyluracil modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nntttgnannntgaagatatan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyluracil modified_base 4 mod_base OTHER note 2-O-methyladenine modified_base 5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-flurocytosine modified_base 7..8 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-O-methylcytosine modified_base 10..11 mod_base OTHER note 2-O-methyladenine modified_base 12 mod_base OTHER note 2-O-methylguanine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluorouracil modified_base 15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-fluorocytosine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nntatnttcaagtnanaaaanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-O-methylguanine modified_base 7 mod_base OTHER note 2-fluorouracil modified_base 8 mod_base OTHER note 2-O-methyladenine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluorocytosine modified_base 11 mod_base OTHER note 2-fluorouracil modified_base 12 mod_base OTHER note 2-O-methyluracil modified_base 13 mod_base OTHER note 2-O-methylguanine modified_base 14..15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-O-methylguanine modified_base 17 mod_base OTHER note 2-O-methyladenine modified_base 20 mod_base OTHER note 2-O-methyluracil modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand modified_base 18 mod_base OTHER note 2-O-methylguanine modified_base 19 mod_base OTHER note 2-O-methyladenine nntttgnannntgaagatatan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyluracil modified_base 4 mod_base OTHER note 2-O-methyladenine modified_base 5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-fluorocytosine modified_base 7 mod_base OTHER note 2-O-methyluracil modified_base 8 mod_base OTHER note 2-fluorouracil modified_base 9 mod_base OTHER note 2-fluorocytosine modified_base 10..11 mod_base OTHER note 2-O-methyladenine modified_base 12 mod_base OTHER note 2-O-methylguanine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluorouracil modified_base 15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-fluorocytosine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nntatntnnaagtnanaaaanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-O-methylguanine modified_base 7 mod_base OTHER note 2-fluorouracil modified_base 8 mod_base OTHER note 2-O-methyladenine modified_base 9 mod_base OTHER note Adenine 2-4-Locked Nucleic Acid modified_base 10 mod_base OTHER note deoxycytosine modified_base 11 mod_base OTHER note deoxythymine 2-4-Locked Nucleic Acid modified_base 12 mod_base OTHER note 2-O-methyluracil modified_base 13 mod_base OTHER note 2-O-methylguanine modified_base 14..15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-O-methylguanine modified_base 17 mod_base OTHER note 2-O-methyladenine modified_base 18 mod_base OTHER note 2-O-methyluracil modified_base 19 mod_base OTHER note 2-O-methyladenine modified_base 20 mod_base OTHER note 2-O-methyluracil modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nntttgnannntgaagatatan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyluracil modified_base 4 mod_base OTHER note 2-O-methyladenine modified_base 5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-flurocytosine modified_base 7..8 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-O-methylcytosine modified_base 10..11 mod_base OTHER note 2-O-methyladenine modified_base 12 mod_base OTHER note 2-O-methylguanine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluorouracil modified_base 15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-fluorocytosine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nntatnttcaagtnanaaaanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-O-methylguanine modified_base 7 mod_base OTHER note 2-fluorouracil modified_base 8 mod_base OTHER note 2-O-methyladenine modified_base 9 mod_base OTHER note 2-fluoroadenine modified_base 10 mod_base OTHER note 2-fluorocytosine modified_base 11 mod_base OTHER note 2-fluorouracil modified_base 12 mod_base OTHER note 2-O-methyluracil modified_base 13 mod_base OTHER note 2-O-methylguanine modified_base 14..15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-O-methylguanine modified_base 17 mod_base OTHER note 2-O-methyladenine modified_base 20 mod_base OTHER note 2-O-methyluracil modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand modified_base 18 mod_base OTHER note 2-O-methylguanine modified_base 19 mod_base OTHER note 2-O-methyladenine nntttgnannntgaagatatan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyluracil modified_base 4 mod_base OTHER note 2-O-methyladenine modified_base 5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-O-methylcytosine modified_base 7..8 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-O-methylcytosine modified_base 10..11 mod_base OTHER note 2-O-methyladenine modified_base 12 mod_base OTHER note 2-O-methylguanine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note deoxythymine 2-4-Locked Nucleic Acid modified_base 15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note Cytosine 2-4-Locked Nucleic Acid modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nntatcttcaagtnanaaaanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3..5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-O-methylguanine modified_base 7 mod_base OTHER note deoxythymine 2-4-Locked Nucleic Acid modified_base 8 mod_base OTHER note 2-O-methyladenine modified_base 9 mod_base OTHER note deoxyadenosine modified_base 10 mod_base OTHER note Cytosine 2-4-Locked Nucleic Acid modified_base 11 mod_base OTHER note deoxythymine modified_base 12 mod_base OTHER note 2-O-methyluracil modified_base 13 mod_base OTHER note 2-O-methylguanine modified_base 14..15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-O-methylguanine modified_base 17 mod_base OTHER note 2-O-methyladenine modified_base 18 mod_base OTHER note 2-O-methyluracil modified_base 19 mod_base OTHER note 2-O-methyladenine modified_base 20 mod_base OTHER note 2-O-methyluracil modified_base 21 mod_base OTHER note 2-O-methyladenine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nntttgnannntgaagatatan 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5-(E)-vinylphosphonate uracil-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluoroadenine-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyluracil modified_base 4 mod_base OTHER note 2-O-methyladenine modified_base 5 mod_base OTHER note 2-O-methyluracil modified_base 6 mod_base OTHER note 2-flurocytosine modified_base 7..8 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-O-methylcytosine modified_base 10..11 mod_base OTHER note 2-O-methyladenine modified_base 12 mod_base OTHER note 2-O-methylguanine modified_base 13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-fluorouracil modified_base 15 mod_base OTHER note 2-O-methyladenine modified_base 16 mod_base OTHER note 2-fluorocytosine modified_base 17..20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methylcytosine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nntatnttcaagtnanaaaanna 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyladenine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-O-methyluracil-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyladenine modified_base 4 mod_base OTHER note 2-O-methylguanine modified_base 5 mod_base OTHER note 2-O-methyladenine modified_base 6 mod_base OTHER note 2-O-methylcytosine modified_base 7 mod_base OTHER note 2-fluoroguanine modified_base 8 mod_base OTHER note 2-O-methyluracil modified_base 9 mod_base OTHER note 2-fluoroguanine modified_base 10 mod_base OTHER note 2-O-methyluracil modified_base 11 mod_base OTHER note deoxythymine modified_base 12..13 mod_base OTHER note 2-O-methyluracil modified_base 14 mod_base OTHER note 2-O-methylguanine modified_base 15 mod_base OTHER note 2-O-methylcytosine modified_base 16..19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methylguanine modified_base 21 mod_base OTHER note 2-O-methylguanine modified_base 22 mod_base OTHER note triantennary N-acetylglucosamine (GalNAc)3 ligand nnagacntntnttgcttttgtn 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2-O-methyladenine-3-phosphorothioate modified_base 2 mod_base OTHER note 2-fluorocytisine-3-phosphorothioate modified_base 3 mod_base OTHER note 2-O-methyladenine modified_base 4..6 mod_base OTHER note 2-fluoroadenine modified_base 7 mod_base OTHER note 2-O-methylguanine modified_base 8 mod_base OTHER note 2-fluorocytosine modified_base 9 mod_base OTHER note 2-O-methyladenine modified_base 10 mod_base OTHER note 2-fluoroadenine modified_base 11 mod_base OTHER note 2-O-methyladenine modified_base 12 mod_base OTHER note 2-fluoroadenine modified_base 13 mod_base OTHER note 2-O-methylcytosine modified_base 14 mod_base OTHER note 2-fluoroadenine modified_base 15 mod_base OTHER note 2-O-methylguanine modified_base 16 mod_base OTHER note 2-fluoroguanine modified_base 17 mod_base OTHER note 2-O-methyluracil modified_base 18 mod_base OTHER note 2-fluorocytosine modified_base 19 mod_base OTHER note 2-O-methyluracil modified_base 20 mod_base OTHER note 2-O-methyladenine modified_base 21 mod_base OTHER note 2-O-methylguanine-3-phosphorothioate modified_base 22 mod_base OTHER note 2-O-methyladenine-3-phosphorothioate modified_base 23 mod_base OTHER note 2-O-methyladenine nnannngnanancngntntanna 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct tggcctgtctgtggaagcg 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct tgccatgactgtcacacttgc 17 DNA PAT source 1..17 mol_type other DNA organism synthetic construct cacccctgccaggtggg 16 DNA PAT source 1..16 mol_type other DNA organism synthetic construct catcccggccgctgac 15 DNA PAT source 1..15 mol_type other DNA organism synthetic construct ccttggccacgccgg 17 DNA PAT source 1..17 mol_type other DNA organism synthetic construct gctgcgcatgctggcac 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct gcagttgagcacgcgcag 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct aaccgtgcccttcccttg 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct gcctatgagggtgccgct 22 DNA PAT source 1..22 mol_type other DNA organism synthetic construct ggcttttccgaataaactccag 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct cccacaggctggaccagct 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct cagcagcaccaccagtggc 15 DNA PAT source 1..15 mol_type other DNA organism synthetic construct cccacccgccagggg 15 DNA PAT source 1..15 mol_type other DNA organism synthetic construct cccacccgccagggg 14 DNA PAT source 1..14 mol_type other DNA organism synthetic construct gcgctggcaggcgg 14 DNA PAT source 1..14 mol_type other DNA organism synthetic construct gcgctggcaggcgg 14 DNA PAT source 1..14 mol_type other DNA organism synthetic construct gcgctggcaggcgg 16 DNA PAT source 1..16 mol_type other DNA organism synthetic construct tcccggaagttgccgg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct gggagtagaggcaggcatcg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct gggagtagaggcaggcatcg 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct cctcgggagctgaggctg 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct cggctggtcttgggcatt 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct cggctggtcttgggcatt 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct ccaaagtccccagggtcac 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct ggggcaaagaggtccacac 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct ggggcaaagaggtccacac 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct tgctgcagtcgctggagg 22 DNA PAT source 1..22 mol_type other DNA organism synthetic construct ccactctgtgacacaaagcagg 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct ggcagcagcctgtgatgtc 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct tgcaatgccagccacgtg 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct cggcagacagcatcatggc 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct cggcagacagcatcatggc 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct caggatgcccttgagggg 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct caggatgcccttgagggg 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct tcgctgttgaagtcagaggagac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct tcgctgttgaagtcagaggagac 17 DNA PAT source 1..17 mol_type other DNA organism synthetic construct aatgccagccccagcgt 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct acaaagtggtcgttgagggc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct acaaagtggtcgttgagggc 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct tgtcataccaggaaatgagcttg 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct ggccatgaggtccaccacc 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct ttactccttggaggccatgtg 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct gctggtggtccaggggtc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct cctcttgtgctcttgctggg 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct ccagcagtgagggtctctctctt 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ctgagtgtggcagggactcc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct agattcagtgtggtggggga 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct tggcaactgtgaggagggg 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct cccctcttcaaggggtctaca 17 DNA PAT source 1..17 mol_type other DNA organism synthetic construct cggctccctaggcccct