YK24038-HG202500263 CN CN2024109094050 2024-07-08 HANGZHOU TIANLONG PHARMACEUTICAL CO., LTD. Hangzhou Tianlong Pharmaceutical Co., Ltd. HUANG, Zeao HUANG Zeao DOUBLE-STRANDED RNAi AGENTS FOR TARGETING AND REGULATING HBV GENE EXPRESSION, AND A USE THEREOF 354 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct ggggtttttcttgttgacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cccgtctgtgccttctcatct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccggaccgtgtgcacttcgct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccgtgtgcacttcgcttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggaccgtgtgcacttcgctt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct ctgctatgcctcatcttctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgctgctatgcctcatcttct 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct ttgtcaacaagaaaaaccccgc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct agatgagaaggcacagacgggga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct agcgaagtgcacacggtccggca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgaagcgaagtgcacacggtccg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aagcgaagtgcacacggtccggc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct aagaagatgaggcatagcagca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct agaagatgaggcatagcagcagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgtgttacaggcggggtttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tacaggcggggtttttcttgt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aggcggggtttttcttgttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcggggtttttcttgttgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggggtttttcttgttgacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtctagactcgtggtggactt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctcgtggtggacttctctcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcgtggtggacttctctcaat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggtggacttctctcaattt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggtggacttctctcaatttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggacttctctcaattttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgtctgcggcgttttatcat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcctgctgctatgcctcatct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atgttgcccgtttgtcctcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgctcaaggaacctctatgt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tagggctttcccccactgttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagttatatggatgatgtggt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctgccgatccatactgcggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atccatactgcggaactccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct accacggggcgcacctctctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cacggggcgcacctctcttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctccccgtctgtgccttctca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccccgtctgtgccttctcat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggtttttcttgttgacaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggacttctctcaattttcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacttctctcaattttctaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtgccttctcatctgccgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccttctcatctgccggaccgt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct tgctgctatgcctcatctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccgtctgtgccttctcatcta 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct gtgtgcacttcgcttcaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtctcttctatcgatcttat 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aaaaccccgcctgtaacacgaga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct acaagaaaaaccccgcctgtaac 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tcaacaagaaaaaccccgcctgt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgtcaacaagaaaaaccccgcct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttgtcaacaagaaaaaccccgcc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aagtccaccacgagtctagactc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttgagagaagtccaccacgagtc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct attgagagaagtccaccacgagt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aaattgagagaagtccaccacga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aaaattgagagaagtccaccacg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct agaaaattgagagaagtccacca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct atgataaaacgccgcagacacat 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct agatgaggcatagcagcaggatg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tagaggacaaacgggcaacatac 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct acatagaggttccttgagcagta 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aaacagtgggggaaagccctacg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct accacatcatccatataactgaa 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttccgcagtatggatcggcagag 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct taggagttccgcagtatggatcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aagagaggtgcgccccgtggtcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct taaagagaggtgcgccccgtggt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgagaaggcacagacggggagtc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct atgagaaggcacagacggggagt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tcttgtcaacaagaaaaaccccg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tagaaaattgagagaagtccacg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tctagaaaattgagagaagtcca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tccggcagatgagaaggcacaga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct acggtccggcagatgagaaggca 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct taagatgaggcatagcagcagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttgtcaacaagaaaaaccccg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atgaggcatagcagcaggatt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tagatgagaaggcacagacgggg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgtgaagcgaagtgcacactt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ataagatcgatagaagagaccca 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ggggtttttcttgttgacaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ggggtttttcttgttgacaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ggggtttttcttgttgacaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ggggtttttcttgttgacaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'- fluoro modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ggggtttttcttgttgacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl cccgtctgtgccttctcatct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl cccgtctgtgccttctcatct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl cccgtctgtgccttctcatct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl cccgtctgtgccttctcatct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl cccgtctgtgccttctcatct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl ccggaccgtgtgcacttcgct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl ccggaccgtgtgcacttcgct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl ccggaccgtgtgcacttcgct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl ccggaccgtgtgcacttcgct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl ccggaccgtgtgcacttcgct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gaccgtgtgcacttcgcttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gaccgtgtgcacttcgcttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gaccgtgtgcacttcgcttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gaccgtgtgcacttcgcttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gaccgtgtgcacttcgcttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl cggaccgtgtgcacttcgctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl cggaccgtgtgcacttcgctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl cggaccgtgtgcacttcgctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl cggaccgtgtgcacttcgctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl cggaccgtgtgcacttcgctt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ctgctatgcctcatcttctt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ctgctatgcctcatcttctt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ctgctatgcctcatcttctt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ctgctatgcctcatcttctt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'- fluoro modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ctgctatgcctcatcttctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tgctgctatgcctcatcttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tgctgctatgcctcatcttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tgctgctatgcctcatcttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tgctgctatgcctcatcttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tgctgctatgcctcatcttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gcggggtttttcttgttgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gcggggtttttcttgttgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gcggggtttttcttgttgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gcggggtttttcttgttgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gcggggtttttcttgttgaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gggtttttcttgttgacaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gggtttttcttgttgacaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gggtttttcttgttgacaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gggtttttcttgttgacaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gggtttttcttgttgacaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gtggacttctctcaattttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gtggacttctctcaattttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gtggacttctctcaattttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gtggacttctctcaattttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gtggacttctctcaattttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tggacttctctcaattttcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tggacttctctcaattttcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tggacttctctcaattttcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tggacttctctcaattttcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tggacttctctcaattttcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gacttctctcaattttctaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gacttctctcaattttctaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gacttctctcaattttctaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gacttctctcaattttctaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gacttctctcaattttctaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tgtgccttctcatctgccgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tgtgccttctcatctgccgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tgtgccttctcatctgccgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tgtgccttctcatctgccgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tgtgccttctcatctgccgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl ccttctcatctgccggaccgt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl ccttctcatctgccggaccgt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl ccttctcatctgccggaccgt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl ccttctcatctgccggaccgt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl ccttctcatctgccggaccgt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl tgctgctatgcctcatctta 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl tgctgctatgcctcatctta 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl tgctgctatgcctcatctta 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl tgctgctatgcctcatctta 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'- fluoro modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl tgctgctatgcctcatctta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tcgtgttacaggcggggtttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tacaggcggggtttttcttgt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl aggcggggtttttcttgttga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl cggggtttttcttgttgacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gtctagactcgtggtggactt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl ctcgtggtggacttctctcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tcgtggtggacttctctcaat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gtggtggacttctctcaattt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tggtggacttctctcaatttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl gtgtctgcggcgttttatcat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tcctgctgctatgcctcatct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl atgttgcccgtttgtcctcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl ctgctcaaggaacctctatgt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tagggctttcccccactgttt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl cagttatatggatgatgtggt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl ctgccgatccatactgcggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl atccatactgcggaactccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl accacggggcgcacctctctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl cacggggcgcacctctcttta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl ctccccgtctgtgccttctca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tccccgtctgtgccttctcat 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl gtgtgcacttcgcttcaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl ggtctcttctatcgatcttat 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl ttgtcaacaagaaaaaccccgc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl ttgtcaacaagaaaaaccccgc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl ttgtcaacaagaaaaaccccgc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl ttgtcaacaagaaaaaccccgc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl ttgtcaacaagaaaaaccccgc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl ttgtcaacaagaaaaaccccgc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl ttgtcaacaagaaaaaccccgc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl ttgtcaacaagaaaaaccccgc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agatgagaaggcacagacgggga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agatgagaaggcacagacgggga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agatgagaaggcacagacgggga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agatgagaaggcacagacgggga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agatgagaaggcacagacgggga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agatgagaaggcacagacgggga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agatgagaaggcacagacgggga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agatgagaaggcacagacgggga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agcgaagtgcacacggtccggca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agcgaagtgcacacggtccggca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agcgaagtgcacacggtccggca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agcgaagtgcacacggtccggca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agcgaagtgcacacggtccggca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agcgaagtgcacacggtccggca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tgaagcgaagtgcacacggtccg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tgaagcgaagtgcacacggtccg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tgaagcgaagtgcacacggtccg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tgaagcgaagtgcacacggtccg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tgaagcgaagtgcacacggtccg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tgaagcgaagtgcacacggtccg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl aagcgaagtgcacacggtccggc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl aagcgaagtgcacacggtccggc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl aagcgaagtgcacacggtccggc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl aagcgaagtgcacacggtccggc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl aagcgaagtgcacacggtccggc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl aagcgaagtgcacacggtccggc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl aagaagatgaggcatagcagca 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl aagaagatgaggcatagcagca 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl aagaagatgaggcatagcagca 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl aagaagatgaggcatagcagca 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl aagaagatgaggcatagcagca 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl aagaagatgaggcatagcagca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agaagatgaggcatagcagcagg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agaagatgaggcatagcagcagg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agaagatgaggcatagcagcagg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agaagatgaggcatagcagcagg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agaagatgaggcatagcagcagg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agaagatgaggcatagcagcagg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tgtcaacaagaaaaaccccgcct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tgtcaacaagaaaaaccccgcct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tgtcaacaagaaaaaccccgcct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tgtcaacaagaaaaaccccgcct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tgtcaacaagaaaaaccccgcct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tgtcaacaagaaaaaccccgcct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tcttgtcaacaagaaaaaccccg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tcttgtcaacaagaaaaaccccg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tcttgtcaacaagaaaaaccccg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tcttgtcaacaagaaaaaccccg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tcttgtcaacaagaaaaaccccg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tcttgtcaacaagaaaaaccccg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agaaaattgagagaagtccacca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agaaaattgagagaagtccacca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agaaaattgagagaagtccacca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agaaaattgagagaagtccacca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agaaaattgagagaagtccacca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agaaaattgagagaagtccacca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tagaaaattgagagaagtccacg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tagaaaattgagagaagtccacg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tagaaaattgagagaagtccacg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tagaaaattgagagaagtccacg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tagaaaattgagagaagtccacg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tagaaaattgagagaagtccacg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tctagaaaattgagagaagtcca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tctagaaaattgagagaagtcca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tctagaaaattgagagaagtcca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tctagaaaattgagagaagtcca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tctagaaaattgagagaagtcca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tctagaaaattgagagaagtcca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tccggcagatgagaaggcacaga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tccggcagatgagaaggcacaga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tccggcagatgagaaggcacaga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tccggcagatgagaaggcacaga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tccggcagatgagaaggcacaga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tccggcagatgagaaggcacaga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl acggtccggcagatgagaaggca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl acggtccggcagatgagaaggca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl acggtccggcagatgagaaggca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl acggtccggcagatgagaaggca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl acggtccggcagatgagaaggca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl acggtccggcagatgagaaggca 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl taagatgaggcatagcagcagg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl taagatgaggcatagcagcagg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl taagatgaggcatagcagcagg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl taagatgaggcatagcagcagg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl taagatgaggcatagcagcagg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl taagatgaggcatagcagcagg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl aaaaccccgcctgtaacacgaga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl acaagaaaaaccccgcctgtaac 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tcaacaagaaaaaccccgcctgt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl ttgtcaacaagaaaaaccccgcc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl aagtccaccacgagtctagactc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl ttgagagaagtccaccacgagtc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl attgagagaagtccaccacgagt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl aaattgagagaagtccaccacga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl aaaattgagagaagtccaccacg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl atgataaaacgccgcagacacat 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agatgaggcatagcagcaggatg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tagaggacaaacgggcaacatac 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl acatagaggttccttgagcagta 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl aaacagtgggggaaagccctacg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl accacatcatccatataactgaa 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl ttccgcagtatggatcggcagag 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl taggagttccgcagtatggatcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl aagagaggtgcgccccgtggtcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl taaagagaggtgcgccccgtggt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl tgagaaggcacagacggggagtc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl atgagaaggcacagacggggagt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note Glycerol nucleic acid modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl tgtgaagcgaagtgcacactt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl ataagatcgatagaagagaccca 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- deoxyribose modified_base 15 mod_base OTHER note 2'- deoxyribose modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ggggtttttcttgttgacaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- deoxyribose modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ggggtttttcttgttgacaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ggggtttttcttgttgacaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- deoxyribose modified_base 15 mod_base OTHER note 2'- deoxyribose modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ggggtttttcttgttgacaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- deoxyribose modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ggggtttttcttgttgacaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ggggtttttcttgttgacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'- deoxyribose modified_base 16 mod_base OTHER note 2'- deoxyribose modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tgctgctatgcctcatcttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'- deoxyribose modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tgctgctatgcctcatcttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl tgctgctatgcctcatcttct 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- deoxyribose modified_base 15 mod_base OTHER note 2'- deoxyribose modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ctgctatgcctcatcttctt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- deoxyribose modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ctgctatgcctcatcttctt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl ctgctatgcctcatcttctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'- deoxyribose modified_base 16 mod_base OTHER note 2'- deoxyribose modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl cccgtctgtgccttctcatct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'- deoxyribose modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl cccgtctgtgccttctcatct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl cccgtctgtgccttctcatct 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- deoxyribose modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl ttgtcaacaagaaaaaccccgc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl ttgtcaacaagaaaaaccccgc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note Glycerol nucleic acid modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl ttgtcaacaagaaaaaccccgc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- deoxyribose modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl ttgtcaacaagaaaaaccccgc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl ttgtcaacaagaaaaaccccgc 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note Glycerol nucleic acid modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl ttgtcaacaagaaaaaccccgc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- deoxyribose modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agaagatgaggcatagcagcagg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agaagatgaggcatagcagcagg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note Glycerol nucleic acid modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agaagatgaggcatagcagcagg 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- deoxyribose modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl aagaagatgaggcatagcagca 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl aagaagatgaggcatagcagca 22 RNA PAT source 1..22 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note Glycerol nucleic acid modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl aagaagatgaggcatagcagca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- deoxyribose modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agatgagaaggcacagacgggga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agatgagaaggcacagacgggga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 5'-Vinyl-(E)-phosphono, 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note Glycerol nucleic acid modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl agatgagaaggcacagacgggga 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl misc_binding 20 bound_moiety G5 ggggtttttcttgttgacaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl misc_binding 20 bound_moiety G101 ggggtttttcttgttgacaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl misc_binding 20 bound_moiety G103 ggggtttttcttgttgacaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl misc_binding 20 bound_moiety G5 ggggtttttcttgttgacaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl misc_binding 20 bound_moiety G101 ggggtttttcttgttgacaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl misc_binding 20 bound_moiety G103 ggggtttttcttgttgacaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G5 cccgtctgtgccttctcatct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G101 cccgtctgtgccttctcatct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G103 cccgtctgtgccttctcatct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G5 ccggaccgtgtgcacttcgct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G101 ccggaccgtgtgcacttcgct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G103 ccggaccgtgtgcacttcgct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G5 gaccgtgtgcacttcgcttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G101 gaccgtgtgcacttcgcttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G103 gaccgtgtgcacttcgcttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G5 gaccgtgtgcacttcgcttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G101 gaccgtgtgcacttcgcttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G103 gaccgtgtgcacttcgcttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G5 cggaccgtgtgcacttcgctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G101 cggaccgtgtgcacttcgctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G103 cggaccgtgtgcacttcgctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'- deoxyribose modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G5 tgctgctatgcctcatcttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'- deoxyribose modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G101 tgctgctatgcctcatcttct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'- deoxyribose modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G103 tgctgctatgcctcatcttct 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- deoxyribose modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl misc_binding 20 bound_moiety G5 ctgctatgcctcatcttctt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- deoxyribose modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl misc_binding 20 bound_moiety G101 ctgctatgcctcatcttctt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- deoxyribose modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl misc_binding 20 bound_moiety G103 ctgctatgcctcatcttctt 19 RNA PAT source 1..19 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl misc_binding 19 bound_moiety GL gtgtgcacttcgcttcaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl misc_binding 21 bound_moiety G5 ggtctcttctatcgatcttat