P26415179SG CN 2024101154015 2024-01-26 CMS RESEARCH & DEVELOPMENT PTE. LTD. CHEN, Shi USES OF DOUBLE-STRANDED SIRNA AND CONJUGATE THEREOF 230 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agctagccaagcagcaaatca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccagtcgtcccagaataacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgagaccattacgtagactta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aatgtggtcaagacggatgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctagccaagcagcaaatcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctcctcaaagccaacaatcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtcttcagcctcctcaaagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tggatcataatggcaatgtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tctacctggatcataatggca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacggatgtgccagatatgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaagacggatgtgccagata 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atcataatggcaatgtggtca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ttatgttgcaggcgagaccat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cccctctctctcctctaccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcttcagcctcctcaaagcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctctacctggatcataatgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gacccccttatgttgcaggca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccttatgttgcaggcgagaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctctggtgctggagctagcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggctcttggacacagcaggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gggtaccagctgaattactga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcttaagatccgagccaatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtgctggagctagccaagcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctggatcataatggcaatgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagtcgtcccagaataactca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aatggcaatgtggtcaagaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caccccaagcagaacgagcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgaccagtcgtcccagaataa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcctcaaagccaacaatcctt 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gccctccggagactacagcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcccaccacctgtaccatgca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aggggtaccagctgaattact 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagccctccggagactacaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cggtcccaccacctgtaccat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtggtcaagacggatgtgcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcaaagccaacaatccttgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cctctacctggatcataatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ccagagccctccggagactaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agctgaattactgcagtggga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggcattgctgcctctttccat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggggtaccagctgaattacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agcctcctcaaagccaacaat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct atgtggtcaagacggatgtga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgctggagctagccaagcaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccagtcgtcccagaataaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aggacccccacctgtgagcct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tgcgacccccttatgttgcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct attgctgcctctttccattct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cacctgtgagcctgcgaccca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctcctctacctggatcataat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgagctctggtgctggagcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaggggtaccagctgaattaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aagcagcaaatcctggatgga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctggcagcccaggcattgcta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaccattacgtagacttccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct caaagccaacaatccttggca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgaggggtaccagctgaatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cttatgttgcaggcgagacca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tcggtcccaccacctgtacca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gtaccagctgaattactgcaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct aggcagcgctgaccagagcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gagaccattacgtagacttca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct tccgagccaatgagcctggaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ggtgctggagctagccaagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct taatggcaatgtggtcaagaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctctggtgctggagctagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gctgaattactgcagtgggca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct ctagccaagcagcaaatccta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cgtcttcagcctcctcaaaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct accagtcgtcccagaataact 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct accattacgtagacttccaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agacggatgtgccagatatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gaggggtaccagctgaattac 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cagagccctccggagactaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct agaccattacgtagacttcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct accattacgtagacttccagg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct cccgaggggtaccagctgaat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct gcaccccaagcagaacgagct 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct actggcaccccaagcagaacg 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct accccaagcagaacgagctct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgatttgctgcttggctagctcc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tagttattctgggacgactggtc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct taagtctacgtaatggtctcgcc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tacatccgtcttgaccacattgc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tggatttgctgcttggctagctc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tggattgttggctttgaggaggc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgctttgaggaggctgaagacgg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tctcattgccattatgatccagg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgccattatgatccaggtagagg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tccatatctggcacatccgtctt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tatctggcacatccgtcttgacc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgaccacattgccattatgatcc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct atggtctcgcctgcaacataagg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct taggtagaggagagagaggggcc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tggctttgaggaggctgaagacg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tccattatgatccaggtagagga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgcctgcaacataagggggtcgc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgtctcgcctgcaacataagggg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tggctagctccagcaccagagct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttcctgctgtgtccaagagccgc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tcagtaattcagctggtacccct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tcattggctcggatcttaagctc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttgcttggctagctccagcacca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tacattgccattatgatccaggt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgagttattctgggacgactggt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgtcttgaccacattgccattat 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tagctcgttctgcttggggtgcc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttattctgggacgactggtcagg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aaggattgttggctttgaggagg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tggctgtagtctccggagggctc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgcatggtacaggtggtgggacc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct agtaattcagctggtacccctcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tctgtagtctccggagggctctg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct atggtacaggtggtgggaccgag 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tggcacatccgtcttgaccacat 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tccaaggattgttggctttgagg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tcattatgatccaggtagaggag 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttagtctccggagggctctggtc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tcccactgcagtaattcagctgg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct atggaaagaggcagcaatgcctg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tagtaattcagctggtacccctc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct attgttggctttgaggaggctga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tcacatccgtcttgaccacattg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tctgcttggctagctccagcacc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tttattctgggacgactggtcag 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct aggctcacaggtgggggtcctcc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttgcaacataagggggtcgcagg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct agaatggaaagaggcagcaatgc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgggtcgcaggctcacaggtggg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct attatgatccaggtagaggagag 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tagctccagcaccagagctcgtt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttaattcagctggtacccctcgg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tccatccaggatttgctgcttgg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tagcaatgcctgggctgccagcc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttggaagtctacgtaatggtctc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgccaaggattgttggctttgag 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct taattcagctggtacccctcggg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tggtctcgcctgcaacataaggg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tggtacaggtggtgggaccgagg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttgcagtaattcagctggtaccc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tggctctggtcagcgctgcctgg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgaagtctacgtaatggtctcgc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttccaggctcattggctcggatc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgcttggctagctccagcaccag 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct ttcttgaccacattgccattatg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgctagctccagcaccagagctc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgcccactgcagtaattcagctg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct taggatttgctgcttggctagct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tctttgaggaggctgaagacggc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct agttattctgggacgactggtca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tctggaagtctacgtaatggtct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tcatatctggcacatccgtcttg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct gtaattcagctggtacccctcgg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tgtagtctccggagggctctggt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct tggaagtctacgtaatggtctcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct cctggaagtctacgtaatggtct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct attcagctggtacccctcgggct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct agctcgttctgcttggggtgcca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct cgttctgcttggggtgccagttt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct agagctcgttctgcttggggtgc 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 11 mod_base OTHER note 2'- fluoro modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl ccagtcgtcccagaataacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl aatgtggtcaagacggatgta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro aggggtaccagctgaattact 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl gtggtcaagacggatgtgcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 10 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl cctctacctggatcataatga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'- fluoro modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl ggggtaccagctgaattacta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 9 mod_base OTHER note 2'- fluoro modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl agcctcctcaaagccaacaat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 10 mod_base OTHER note 2'- fluoro modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate gaccagtcgtcccagaataaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl gaccattacgtagacttccaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl cgaggggtaccagctgaatta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 9 mod_base OTHER note 2'- fluoro accagtcgtcccagaataact 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro ctcctctacctggatcataat 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 9 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl variation 18 note N is R ccagtcgtcccagaatancta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro variation order(3,18) note N is R ccngtcgtcccagaatancta 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 11 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 9 mod_base OTHER note 2'- fluoro gaggggtaccagctgaattaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 10 mod_base OTHER note 2'- fluoro modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 8 mod_base OTHER note 2'- fluoro modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl aggggtaccagctgaattaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro cagagccctccggagactaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl agaccattacgtagacttcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro accattacgtagacttccaga 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro cccgaggggtaccagctgaaa 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl gcaccccaagcagaacgagca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 6 mod_base OTHER note 2'-O- methyl actggcaccccaagcagaaca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 11 mod_base OTHER note 2'- fluoro modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'-O- methyl accccaagcagaacgagctca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl agaccattacgtagacttcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'- fluoro modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate agaccattacgtagacttcca 18 RNA PAT source 1..18 mol_type other RNA organism synthetic construct modified_base 4 mod_base OTHER note 2'- fluoro modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl ccattacgtagacttcca 18 RNA PAT source 1..18 mol_type other RNA organism synthetic construct modified_base 6 mod_base OTHER note 2'- fluoro modified_base 3 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'- fluoro modified_base 7 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'- fluoro ccattacgtagacttcca 21 RNA PAT source 1..21 mol_type other RNA organism synthetic construct modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'- fluoro modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'- fluoro modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'- fluoro modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl agaccattacgtagacttcca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 20 mod_base OTHER note 2'-O- methyl tagttattctgggacgactggtc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose tacatccgtcttgaccacattgc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 14 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate agtaattcagctggtacccctcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 18 mod_base OTHER note 2'-O- methyl tggcacatccgtcttgaccacat 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 14 mod_base OTHER note 2'- fluoro modified_base 9 mod_base OTHER note 2'-O- methyl tcattatgatccaggtagaggag 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl tagtaattcagctggtacccctc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 14 mod_base OTHER note 2'- fluoro modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl attgttggctttgaggaggctga 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 14 mod_base OTHER note 2'- fluoro modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl tttattctgggacgactggtcag 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl ttggaagtctacgtaatggtctc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro taattcagctggtacccctcggg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl agttattctgggacgactggtca 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 14 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl attatgatccaggtagaggagag 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose variation 7 note N is Z tagttantctgggacgactggtc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate variation 5 note N is Z tagtnattctgggacgactggtc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro variation 7 note N is Z tagttantctgggacgactggtc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 12 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl variation 7 note N si Z tagttantctgggacgactggtc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 3'- thiophosphate modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate variation 1 note N is B19 variation 5 note N is Z variation 17 note N is R nagtnattctgggacgnctggtc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 1 mod_base OTHER note 3'- thiophosphate modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl variation 5 note N is Z variation 17 note N is R variation 1 note N is B19 nagtnattctgggacgnctggcc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate variation 19 note N is R variation 5 note N is Z tagtnattctgggacgacnggcc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl variation 19 note N is R variation 5 note N isR tagtnattctgggacgacnggtc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 10 mod_base OTHER note 2'-O- methyl variation 5 note N is R variation 7 note N is R variation 19 note N is R tagtnantctgggacgacnggtc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 14 mod_base OTHER note 2'- fluoro variation 19 note N is R variation 7 note N is R tagttantctgggacgacnggtc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate ttaattcagctggtacccctcgg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate tgtaattcagctggtacccctcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose tgtagtctccggagggctctggt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 7 mod_base OTHER note 2'- deoxyribose tggaagtctacgtaatggtctcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose tctggaagtctacgtaatggtct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 14 mod_base OTHER note 2'- fluoro modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl tttcagctggtacccctcgggct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 14 mod_base OTHER note 2'- fluoro modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl tgctcgttctgcttggggtgcct 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl tgttctgcttggggtgccagttt 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro tgagctcgttctgcttggggtgt 24 RNA PAT source 1..24 mol_type other RNA organism synthetic construct modified_base 2 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 15 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'- deoxyribose modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 5 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 4 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'- deoxyribose modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'- deoxyribose modified_base 3 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 24 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 7 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl ttggaagtctacgtaatggtctcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 16 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 3 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 18 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 3'- thiophosphate variation 1 note N is B33 nggaagtctacgtaatggtctcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 14 mod_base OTHER note 2'- fluoro modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl variation 7 note N is R tggaagnctacgtaatggtctcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 3'- thiophosphate modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 14 mod_base OTHER note 2'- fluoro modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl variation 7 note N is R variation 1 note N is B33 nggaagnctacgtaatggtctcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 20 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 12 mod_base OTHER note 2'- fluoro modified_base 1 mod_base OTHER note 3'- thiophosphate modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 14 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'- fluoro variation 7 note N is Z variation 1 note N is B33 nggaagnctacgtaatggtctcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 14 mod_base OTHER note 2'- fluoro modified_base 16 mod_base OTHER note 2'- fluoro modified_base 2 mod_base OTHER note 2'- fluoro, 3'- thiophosphate modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 3'- thiophosphate modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 18 mod_base OTHER note 2'- fluoro modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- fluoro modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 5 mod_base OTHER note 2'- fluoro variation 1 note N is B33 nggaagtctacgtaatggtctcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 3 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 23 mod_base OTHER note 2'-O- methyl tggaagtctacgtaatggtctcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 3 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 3'- thiophosphate modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl variation 1 note N is B33 nggaagtctacgtaatggtctcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 1 mod_base OTHER note 3'- thiophosphate modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate variation 1 note N is B33 nggaagtctacgtaatggtctcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 12 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 19 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 14 mod_base OTHER note 2'- fluoro modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 5 mod_base OTHER note 2'- deoxyribose modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 1 mod_base OTHER note 3'- thiophosphate modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 9 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl variation 1 note N is B33 variation 7 note N is R nggaagnctacgtaatggtctcg 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct modified_base 2 mod_base OTHER note 2'- deoxyribose, 3'- thiophosphate modified_base 15 mod_base OTHER note 2'-O- methyl modified_base 13 mod_base OTHER note 2'-O- methyl modified_base 3 mod_base OTHER note 2'-O- methyl modified_base 4 mod_base OTHER note 2'-O- methyl modified_base 20 mod_base OTHER note 2'-O- methyl modified_base 6 mod_base OTHER note 2'-O- methyl modified_base 1 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 12 mod_base OTHER note 2'- deoxyribose modified_base 16 mod_base OTHER note 2'-O- methyl modified_base 11 mod_base OTHER note 2'-O- methyl modified_base 7 mod_base OTHER note 2'- deoxyribose modified_base 22 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 17 mod_base OTHER note 2'-O- methyl modified_base 23 mod_base OTHER note 2'-O- methyl modified_base 14 mod_base OTHER note 2'- fluoro modified_base 21 mod_base OTHER note 2'-O- methyl, 3'- thiophosphate modified_base 10 mod_base OTHER note 2'-O- methyl modified_base 8 mod_base OTHER note 2'-O- methyl modified_base 18 mod_base OTHER note 2'-O- methyl modified_base 9 mod_base OTHER note 2'-O- methyl variation 19 note N is R variation 5 note N is Z tagtnattctgggacgacnggtc