1119-75 PCT US 63/283,359 2021-11-26 The Rockefeller University Robert B. DARNELL MARKERS AND CELLULAR ANTECEDENTS OF RHEUMATOID ARTHRITIS FLARES 28 22 DNA PAT misc_feature 1..22 note Description of sequence: COL14A1 (NM_021110.4) -Forward Sequence 1 source 1..22 mol_type other DNA organism synthetic construct cacaaacctcctcagcggaatg 22 DNA PAT misc_feature 1..22 note Description of sequence: COL14A1 (NM_021110.4) -Reverse Sequence 1 source 1..22 mol_type other DNA organism synthetic construct ggcttggagattggtaacaccc 21 DNA PAT misc_feature 1..21 note Description of sequence: COL14A1 (NM_021110.4) -Forward Sequence 2 source 1..21 mol_type other DNA organism synthetic construct atactccgagggaagagagca 20 DNA PAT misc_feature 1..20 note Description of sequence: COL14A1 (NM_021110.4) -Reverse Sequence 2 source 1..20 mol_type other DNA organism synthetic construct caaccagtaccgcatcttgc 22 DNA PAT misc_feature 1..22 note Description of sequence: DCLK1 (NM_001330071.2) -Forward Sequence 1 source 1..22 mol_type other DNA organism synthetic construct accgatgccatcaagctggact 22 DNA PAT misc_feature 1..22 note Description of sequence: DCLK1 (NM_001330071.2) -Reverse Sequence 1 source 1..22 mol_type other DNA organism synthetic construct tcctggtaacggaacttctccg 20 DNA PAT misc_feature 1..20 note Description of sequence: DCLK1 (NM_001330071.2) -Forward Sequence 2 source 1..20 mol_type other DNA organism synthetic construct gcatttcaatgaggacgggc 20 DNA PAT misc_feature 1..20 note Description of sequence: DCLK1 (NM_001330071.2) -Reverse Sequence 2 source 1..20 mol_type other DNA organism synthetic construct tacaggcgtttcaccactcc 22 DNA PAT misc_feature 1..22 note Description of sequence: FNDC1 (NM_032532)-Forward Sequence 1 source 1..22 mol_type other DNA organism synthetic construct tgcatcttgggatgcgctacca 22 DNA PAT misc_feature 1..22 note Description of sequence: FNDC1 (NM_032532)-Reverse Sequence 1 source 1..22 mol_type other DNA organism synthetic construct ggcagaagtagtgtctccagga 21 DNA PAT misc_feature 1..21 note Description of sequence: FNDC1 (NM_032532)-Forward Sequence 2 source 1..21 mol_type other DNA organism synthetic construct gatgctaccagtagacctgtg 21 DNA PAT misc_feature 1..21 note Description of sequence: FNDC1 (NM_032532) -Reverse Sequence 2 source 1..21 mol_type other DNA organism synthetic construct ggcacttccttttctgtgacg 20 DNA PAT misc_feature 1..20 note Description of sequence: COL16A1 (NM_001856.4)-Forward Sequence 1 source 1..20 mol_type other DNA organism synthetic construct aggctatggcaagatgggtg 20 DNA PAT misc_feature 1..20 note Description of sequence: COL16A1 (NM_001856.4)-Reverse Sequence 1 source 1..20 mol_type other DNA organism synthetic construct tgttcctgggactaaacggg 22 DNA PAT misc_feature 1..22 note Description of sequence: COL16A1 (NM_001856.4)-Forward Sequence 2 source 1..22 mol_type other DNA organism synthetic construct aacagtgagggagatcctggct 22 DNA PAT misc_feature 1..22 note Description of sequence: COL16A1 (NM_001856.4) -Reverse Sequence 2 source 1..22 mol_type other DNA organism synthetic construct caacagcaccaggaaaacctgg 20 DNA PAT misc_feature 1..20 note Description of sequence: COL1A2 (NM_000089.4)-Forward Sequence 1 source 1..20 mol_type other DNA organism synthetic construct cctctggagaggctggtact 20 DNA PAT misc_feature 1..20 note Description of sequence: COL1A2 (NM_000089.4) -Reverse Sequence 1 source 1..20 mol_type other DNA organism synthetic construct taaccaccaccgcttacacc 23 DNA PAT misc_feature 1..23 note Description of sequence: COL1A2 (NM_000089.4)-Forward Sequence 2 source 1..23 mol_type other DNA organism synthetic construct cctggtgctaaaggagaaagagg 22 DNA PAT misc_feature 1..22 note Description of sequence: COL1A2 (NM_000089.4) -Reverse Sequence 2 source 1..22 mol_type other DNA organism synthetic construct atcaccacgacttccagcagga 22 DNA PAT misc_feature 1..22 note Description of sequence: KIAA1755 (NM_001348708.2)-Forward Sequence source 1..22 mol_type other DNA organism synthetic construct ggtgtcaaggttttccgctcca 23 DNA PAT misc_feature 1..23 note Description of sequence: KIAA1755 (NM_001348708.2)-Reverse Sequence source 1..23 mol_type other DNA organism synthetic construct cttggtgacctctgaaactgtgc 22 DNA PAT misc_feature 1..22 note Description of sequence: PXDN (NM_012293.3) -Forward Sequence source 1..22 mol_type other DNA organism synthetic construct cggacattgcagctcattcagg 22 DNA PAT misc_feature 1..22 note Description of sequence: PXDN (NM_012293.3) -Reverse Sequence source 1..22 mol_type other DNA organism synthetic construct ccgacaggtttgcgatgaggtt 21 DNA PAT misc_feature 1..21 note Description of sequence: COL5A1 (NM_000093.5) -Forward Sequence 1 source 1..21 mol_type other DNA organism synthetic construct caaagaaaacccgggctcctg 20 DNA PAT misc_feature 1..20 note Description of sequence: COL5A1 (NM_000093.5) -Reverse Sequence 1 source 1..20 mol_type other DNA organism synthetic construct tgtgacgcttcaccgaagtc 21 DNA PAT misc_feature 1..21 note Description of sequence: COL5A1 (NM_000093.5) -Forward Sequence 2 source 1..21 mol_type other DNA organism synthetic construct gaattcaagcgtgggaaactg 20 DNA PAT misc_feature 1..20 note Description of sequence: COL5A1 (NM_000093.5) -Reverse Sequence 2 source 1..20 mol_type other DNA organism synthetic construct actttgggggtgtcgatctc