4239-106941-02 US 63/239,797 2021-09-01 The United States of America, as represented by the Secretary, Department of Health and Human Services LZK INHIBITORS AND METHODS OF USE 20 26 DNA PAT source 1..26 mol_type other DNA organism synthetic construct ctgtgcccatggatcactctacgagg 26 DNA PAT source 1..26 mol_type other DNA organism synthetic construct cctcgtagagtgatccatgggcacag 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct gaggtggccatcaagaaagtgagag 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct ctctcactttcttgatggccacctc 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct taatctagaatggccaactttcaggagcacct 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct ttagcggccgcttaccaggtagcagagctgtagt 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct taatacgactcactataggg 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct tagaaggcacagtcgagg 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct taatctagaatgctgggtagtggagcccaagg 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct ttagcggccgcttaggcaatgtctaaatgcatga 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct ttagcggccgcttacactgcttgctcacgcttaa 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct ttagcggccgcttaccaggtagcagagctgtagt 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct aactgattcgaaggcgcaga 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct gggcgttttccaagagagga 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct ggcaccacaccttctacaatg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct gtggtggtgaagctgtagcc 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct ccatggagaaggctgggg 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct gtccaccaccctgttgctgta 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct cggaatgaacctgtctctgaa 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct gatgtagattcttcagccatt