CN 2309838TW07-EP US 63/373,964 2022-08-30 U-Neuron biomedical Inc. Hwang, Shiaw-Min COMPOSITION COMPRISING AMNIOTIC FLUID STEM CELLS OR DERIVATIVES THEREOF AND METHOD OF USING THE SAME 26 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tttgaccggggtggtagaac 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tgcggatggcacaacataga 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct cggtagtgcctgtgactgtt 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct tcaccggcaatttagagacca 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ccatctgtgctgcgaacaac 24 DNA PAT source 1..24 mol_type other DNA organism synthetic construct atcgttcctattggtatccgatgt 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct agcagcatcccagaagatcc 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct tttcctcacaaagtgggagcg 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct ctgacagtggtggttccagtc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tgttggagacggtgggattc 24 DNA PAT source 1..24 mol_type other DNA organism synthetic construct cctcctccaggaagtccaaaagac 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct cctggagttctcaccttctgc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tccatcagcgctcccatttt 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct gagtgggagcgaggctattc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct cgcaagatggcccaagagaa 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ttcatgtgcgcgtagctgtc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ccatgtggggtaaccagacc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct tcctaaggggaagcggtaca 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ccctggccaaggtcattcat 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct accttactccttggaggcca 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct tcgtcagaaaaggagagggga 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct ttggcggttagttctgcgtt 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct cacccgtcaccttagtgtct 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct tagcttcaggcagatgctgtg 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct ccacccaggatgagcagac 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct actaggatctggtggtgcct